ID: 930215944

View in Genome Browser
Species Human (GRCh38)
Location 2:48697484-48697506
Sequence TGTTTTGGAAGATCAGTTAA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 293
Summary {0: 1, 1: 0, 2: 0, 3: 26, 4: 266}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
930215942_930215944 24 Left 930215942 2:48697437-48697459 CCTCAGGCTTTCACACAGTATTT 0: 1
1: 0
2: 0
3: 14
4: 251
Right 930215944 2:48697484-48697506 TGTTTTGGAAGATCAGTTAATGG 0: 1
1: 0
2: 0
3: 26
4: 266

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
930215944 Original CRISPR TGTTTTGGAAGATCAGTTAA TGG Intronic
901583454 1:10265534-10265556 TGTGTTTTAAAATCAGTTAAAGG - Intronic
904423988 1:30411808-30411830 TCTTGTGGAAGATCTGTTAAGGG + Intergenic
904801824 1:33098447-33098469 TGTTGTCAAAGATCAGTTAATGG - Intronic
908078269 1:60544877-60544899 TGTATTGGAAGATGATTTTATGG - Intergenic
908311177 1:62885988-62886010 TGTCTTGGAAGATTAGATCAAGG + Intergenic
910514564 1:88045617-88045639 AGTCTTGGAAGATCTGTGAAAGG - Intergenic
911258081 1:95655365-95655387 TGTTTTGGAAGATCATTGAGAGG + Intergenic
911352467 1:96771219-96771241 TTTTTTTGAAGATGTGTTAATGG + Intronic
911517840 1:98889754-98889776 TCTTTTAGAATATCAATTAAGGG - Intergenic
912770607 1:112461298-112461320 TGTTGTGAAAGAACAGGTAAGGG - Intronic
912785005 1:112594101-112594123 TTCTTTGGTAGATCAGTTATAGG - Intronic
916163996 1:161948145-161948167 TGGTTTGGATTATCAGTTCATGG + Intronic
916474363 1:165154622-165154644 ACTATTGGAAGAACAGTTAATGG - Intergenic
918204698 1:182298496-182298518 TGCTTTGGAAGAACTTTTAATGG + Intergenic
918674686 1:187268349-187268371 TTTAGTGGAAGATCAGTAAAGGG + Intergenic
919294979 1:195686220-195686242 TGTTTTGGACCATCTGTTCAAGG - Intergenic
919704799 1:200666450-200666472 TGTTTTGGAAAATGACTTAACGG + Exonic
920792276 1:209104539-209104561 TGTGTGGGAATATCAGCTAAAGG - Intergenic
922495029 1:226050240-226050262 TGGTTTGGAGCATCATTTAAGGG - Intergenic
923426437 1:233874365-233874387 TTTCTTGGAATATCAGTGAAAGG - Intergenic
1063647513 10:7899751-7899773 TGTTTTTGAAGATCACGTTAGGG + Intronic
1064039139 10:11943370-11943392 TGTATTGTTAGATCAGTTGAAGG - Intronic
1064293123 10:14053513-14053535 TGTATTGGAAGCTCAGTTCTAGG - Intronic
1065240424 10:23698533-23698555 TATTTTGGAAATTTAGTTAAGGG + Intronic
1065458279 10:25930686-25930708 TGATCTGGGAGATCAATTAAGGG - Intergenic
1066929127 10:41734796-41734818 TGTTTTGGAAAATTGGTGAATGG + Intergenic
1067191083 10:44068897-44068919 TGGTTTGGAAGATGAATTATAGG - Intergenic
1067374666 10:45716760-45716782 TTTTCTGGAAGAGCAGTCAATGG + Intergenic
1067379066 10:45755784-45755806 TTTTCTGGAAGAGCAGTCAATGG - Intronic
1067882475 10:50058398-50058420 TTTTCTGGAAGACCAGTCAATGG + Intergenic
1067886769 10:50096447-50096469 TTTTCTGGAAGAGCAGTCAATGG - Intronic
1068329327 10:55540643-55540665 TGTTATGTAATATCAATTAAAGG + Intronic
1074702121 10:116101721-116101743 TGTTCTGGAAGAATATTTAAAGG - Intronic
1074722599 10:116275134-116275156 TCTTTTGGAAAATCAGTAATTGG + Intergenic
1075743178 10:124708349-124708371 TGTTTTCGAAGAACAGTAGAAGG - Intronic
1076738646 10:132469737-132469759 TGTTTAGGAAAATATGTTAATGG + Intergenic
1078980706 11:16529805-16529827 TCTTTTGGATTATCTGTTAAAGG - Intronic
1079929192 11:26536651-26536673 TGTTTTCGAAGAGTAATTAAGGG - Intronic
1082300888 11:50504372-50504394 TGTTTTGTAGGATCTGTGAAGGG - Intergenic
1082306134 11:50578097-50578119 TGTTTTGGAAGATCCTTGCAGGG - Intergenic
1082310382 11:50638861-50638883 TGTTTTTGTAGATCTGTGAAGGG + Intergenic
1082580493 11:54861168-54861190 TGTTTTGTAAAATCTGTGAAGGG + Intergenic
1088765344 11:112970089-112970111 TGCTATTGAAGAGCAGTTAAAGG + Intronic
1090146025 11:124323590-124323612 TGTTTAGGAAAATCATTTGAAGG - Intergenic
1090901953 11:131039810-131039832 TGTATTGTAAGAGCATTTAAGGG - Intergenic
1091461903 12:649891-649913 TGTTTTGGAAGAATACTTAAGGG - Intronic
1093116620 12:15219984-15220006 TGTTTAGAAAAATCACTTAAAGG + Intronic
1093637283 12:21486532-21486554 TCTTATGGAAGACCAATTAATGG - Exonic
1094868726 12:34573756-34573778 TTTTTTGGAAAATCTGTGAAGGG - Intergenic
1095079559 12:37982671-37982693 TGTTTTTGTAGATCAATGAAGGG + Intergenic
1096031114 12:48416049-48416071 TGTTTTGGAAGTACAGTTATAGG - Intergenic
1096987219 12:55768037-55768059 GGTTGTGGAAGAACAGTTACTGG + Intronic
1097390545 12:59007065-59007087 CTTTCTGGAAGATCAGTGAAAGG - Intergenic
1097480768 12:60122835-60122857 TGTTTTGGGAGATCGATTATGGG - Intergenic
1097607979 12:61779386-61779408 TGATTTGGAAGATAAATTATAGG - Intronic
1098706154 12:73692377-73692399 GGATTTGGAAGAACAGGTAATGG + Intergenic
1100650395 12:96581805-96581827 TGTTTTGGAAGAATACTTAATGG - Intronic
1100822020 12:98440381-98440403 TGTGTGGGAATATCATTTAAGGG + Intergenic
1101089132 12:101266728-101266750 TGTTTTGAAAGAGAACTTAAGGG - Intergenic
1105552982 13:21415543-21415565 TGTGATGGAAGATTAGATAAGGG - Intronic
1107579194 13:41764064-41764086 TGTTTCAGAAGTTCAGTTGACGG - Intronic
1107946884 13:45427147-45427169 TGTTTTGGGATATCAGTTTTGGG - Intergenic
1109016991 13:57029298-57029320 TGTTTTGAAAAAACATTTAAGGG + Intergenic
1109564438 13:64093617-64093639 TCTTTTGAAAAATCAGTCAAGGG + Intergenic
1110736408 13:78942347-78942369 TGTTTTGGAGGACTAGTTAGGGG - Intergenic
1111338969 13:86858714-86858736 AGATTTGGAAGTTCAATTAAAGG - Intergenic
1112160276 13:96859919-96859941 TGTTTTGGAAAATCACTAAGAGG - Intergenic
1112786362 13:102955859-102955881 TGTTTTAGAGGATCAGATTAAGG + Intergenic
1112898771 13:104334634-104334656 TGTTTTAGAACAGCAGTTTATGG - Intergenic
1114198048 14:20496259-20496281 TGTGCTGGAAGATAAGTAAAAGG + Intergenic
1115006279 14:28489446-28489468 TGTTTTGGAAAAACATCTAAAGG + Intergenic
1116570315 14:46508542-46508564 TGTTTAAGAGGATCAGTTTAAGG + Intergenic
1118062149 14:62151337-62151359 TTTTTAGAAAGACCAGTTAAAGG - Intergenic
1202886958 14_KI270722v1_random:116640-116662 TGCTCTGGAATATCATTTAATGG + Intergenic
1124021617 15:25930722-25930744 TCTTTTAAAAGATCAGTTATCGG + Intergenic
1128691645 15:69728763-69728785 TGTTTTTGAAGATTATTTCATGG - Intergenic
1130915552 15:88301832-88301854 TGTCTTGGAAGATCAAGAAAGGG - Intergenic
1131682185 15:94735624-94735646 TGGTTTGGCAGAATAGTTAAAGG - Intergenic
1135227101 16:20670432-20670454 AGTTAGGGAAGACCAGTTAAAGG - Intronic
1136738376 16:32486155-32486177 TGTTTTGTAGGATCTGTGAAGGG + Intergenic
1136742245 16:32546401-32546423 TGTTTTGTAGGATCTGTGAAGGG + Intergenic
1138972540 16:62163261-62163283 TTTTTTAAAAGACCAGTTAAAGG - Intergenic
1141077675 16:81022433-81022455 TGTTTTTGAAGCTCAGTAACAGG + Intronic
1141294586 16:82755391-82755413 TGTTTGGGAAGATTAGAAAAGGG + Intronic
1203027353 16_KI270728v1_random:528828-528850 TGTTTTGTAGGATCTGTGAAGGG - Intergenic
1203044368 16_KI270728v1_random:805603-805625 TGTTTTGTAGGATCTGTGAAGGG + Intergenic
1143982703 17:10883711-10883733 TGGTATGGAAGATCAGTAACGGG + Intergenic
1146482098 17:33213057-33213079 TGTTTTGGATGCTCTTTTAATGG - Intronic
1146898587 17:36564986-36565008 TGTTATGTAAGATCACCTAAAGG + Intronic
1147795890 17:43042501-43042523 TGTTTTGTAAAATGAGATAAAGG + Intergenic
1150187243 17:63196127-63196149 TGTAATGTAATATCAGTTAATGG - Intronic
1150883401 17:69057601-69057623 TGTTGTAGTAGGTCAGTTAATGG - Intronic
1151283648 17:73094407-73094429 CATTTTGGAAGATGAGTTGATGG - Intergenic
1153714914 18:7838496-7838518 TTTTTTGGGAGATAAATTAAGGG - Intronic
1155952145 18:31924921-31924943 TGGTTTGGCAGATCATTTATAGG - Intronic
1157175895 18:45451844-45451866 TGTTTTGAAAGATCATATTATGG + Intronic
1158056193 18:53284185-53284207 TGTTATGTAAGATCACTAAAAGG + Intronic
1158063803 18:53380464-53380486 TGTTCTGGAAGATCAATTATTGG + Intronic
1159435786 18:68415087-68415109 TGTGCTGGAAGATCAGATCAAGG + Intergenic
1159544890 18:69827114-69827136 TGGTTTGGAAGCTCATTCAATGG - Intronic
1159718172 18:71851034-71851056 GGATTTTGAAGATCAGTTTAAGG - Intergenic
1159823255 18:73173505-73173527 TGTTTCTGTAGATCAGTGAAGGG - Intronic
1164055938 19:21622308-21622330 AGTTTTGGAAGCCCAATTAAGGG + Intergenic
1164332742 19:24275802-24275824 TCTTTTGCTAGATCTGTTAAGGG - Intergenic
1164366074 19:27583148-27583170 TTTTTTGTAAAATCAGTGAAGGG + Intergenic
1167274082 19:48525015-48525037 TGTTTTGAAATATCAGTTATAGG + Intergenic
1202662378 1_KI270708v1_random:83585-83607 TGCTCTGGAATATCATTTAATGG + Intergenic
925363213 2:3294233-3294255 TGTGTTTGAACATCAGTTCAAGG - Intronic
927745887 2:25620543-25620565 TTTTCTGAAAGATTAGTTAATGG + Intronic
927820253 2:26258119-26258141 CGTTTCGGAGGCTCAGTTAAGGG - Intronic
928456106 2:31423962-31423984 TGTTATGGTTGATCAGTAAATGG - Intergenic
928731117 2:34234317-34234339 TTTCCTGGAAGATCAGATAAAGG - Intergenic
930215944 2:48697484-48697506 TGTTTTGGAAGATCAGTTAATGG + Intronic
931352529 2:61504558-61504580 ATTTTTGGAAAAGCAGTTAAAGG + Intronic
937139942 2:119591214-119591236 TGCTTTGGAAAATCTTTTAAAGG - Intronic
937422825 2:121772742-121772764 TGTTTTGAAAGCACAGTTGATGG + Intergenic
939621434 2:144423930-144423952 TATTTTGGAAGATAATTTTATGG + Intronic
940389313 2:153113091-153113113 TGTTTTTGAAAATCAGTAACTGG - Intergenic
941522533 2:166564271-166564293 TTTTCTGGAAGATGTGTTAATGG - Intergenic
942474270 2:176299730-176299752 TGTTTAGAAGAATCAGTTAAAGG + Intronic
945410480 2:209500541-209500563 GCTTTTGGGAGATCAGTGAAGGG - Intronic
946585729 2:221185547-221185569 TGATATGGAAAATCAGTAAAGGG - Intergenic
1169975988 20:11328426-11328448 AGTGTTGGATGATAAGTTAAAGG + Intergenic
1170149165 20:13210479-13210501 TCTTTTGGAAGATTTTTTAATGG + Intergenic
1170872737 20:20222140-20222162 TGATTTGGAAGCTAAGTTGAGGG - Intronic
1173263206 20:41454852-41454874 CATTTTGGAAGCTCTGTTAAGGG - Intronic
1176882113 21:14208438-14208460 TGCTTTGGAAGAGATGTTAAAGG - Intronic
1177166167 21:17606710-17606732 TGTTTTTGAAGAGTAGTTAATGG - Intronic
1180183023 21:46126420-46126442 TGTCTAGGCAGATCAGTGAACGG + Intronic
1180329194 22:11461128-11461150 TGCTCTGGAATATCATTTAATGG + Intergenic
950317383 3:12015686-12015708 TGTTTAGGAACATCAGACAAGGG - Intronic
950438942 3:12996175-12996197 TTTTTTTAAAGAGCAGTTAAGGG + Intronic
951130886 3:19043229-19043251 TTTTTAGGAAGTTAAGTTAATGG - Intergenic
952582269 3:34848427-34848449 TGTTTAGGCAGATCACTAAAAGG - Intergenic
954868180 3:53747350-53747372 TGTTTTGCCAGATCCGTTCACGG - Exonic
955134903 3:56207515-56207537 TGTTTTTGAGGAATAGTTAATGG - Intronic
957833307 3:85551578-85551600 TCTTTTCAAAAATCAGTTAAAGG + Intronic
958568295 3:95845119-95845141 TGTTTTTGAATATAAATTAATGG - Intergenic
959348450 3:105229487-105229509 TGTTTTGCAAGAGCAGCTAAGGG - Intergenic
959675562 3:109031342-109031364 TGTATGGGAAGCTTAGTTAAAGG + Intronic
960110755 3:113842411-113842433 TGTTTTGTTAGATCAGTTTATGG + Intronic
960927249 3:122807006-122807028 TTTTTAAGAAGATCAGTAAAGGG + Intronic
962130643 3:132670432-132670454 TGTATTAGAATATCATTTAAAGG + Intronic
962493488 3:135916825-135916847 TGCTTTGGACAATCAGGTAAGGG - Intergenic
963502722 3:146148113-146148135 TGTTTAGGAAGATAAATTTATGG + Intronic
964010026 3:151881431-151881453 TCTTTTGGGAGATCACTTCAGGG + Exonic
966823750 3:183945933-183945955 TGTTTTCCATTATCAGTTAACGG - Exonic
967996622 3:195171685-195171707 TGTTTTGGAAGAGGAGAGAAAGG - Intronic
969017460 4:4113443-4113465 TGTTTTGGAAGCTGGGTGAATGG + Intergenic
972200763 4:36712334-36712356 TGTTTTGAAATATCTGTTATAGG - Intergenic
974545039 4:63292442-63292464 TGCTTTGGAAGTTCTGTTTAGGG - Intergenic
974580212 4:63788988-63789010 TCTGTTGGAATATCAGTTTAAGG + Intergenic
974737867 4:65962227-65962249 AGTTATTGAAGATCAGTTAATGG + Intergenic
975486728 4:74941835-74941857 TGTTTTTGAAGAGCAGTTCTAGG - Intronic
975611926 4:76212391-76212413 ACTTTTGGAAACTCAGTTAAAGG + Intronic
975730938 4:77336600-77336622 TGTTTGGGCAGACCAATTAATGG + Intronic
975801502 4:78063387-78063409 GGTTTTGGAAGCTGTGTTAATGG + Intronic
976107155 4:81631183-81631205 TCTTTGGGAAGATAATTTAAAGG + Intronic
976978582 4:91195078-91195100 TGTTTTTGAGCATCAGTAAATGG + Intronic
977636879 4:99308861-99308883 TGTTTTTGATGACGAGTTAATGG + Intronic
977965016 4:103135395-103135417 TATTTTTGAATCTCAGTTAATGG + Intronic
978032571 4:103953275-103953297 TCTTTTGGAAGAACATTTTATGG - Intergenic
978192196 4:105926808-105926830 TGTTTTGGAACTTCAATTCAAGG - Intronic
978290084 4:107127605-107127627 TGATTTTGAAGATTAGGTAATGG + Intronic
978692189 4:111527118-111527140 TGTTTTTGATGATCATTTTATGG + Intergenic
978821916 4:112976726-112976748 TGTTTTGGGAGCTCTCTTAAAGG - Intronic
980540588 4:134188327-134188349 TTATTTGGTAGATCAATTAAAGG + Intergenic
980641091 4:135580920-135580942 TGTTATGAAAAATCAATTAAGGG + Intergenic
980935521 4:139221995-139222017 TGTTATGGAGAATTAGTTAAAGG + Intergenic
981421306 4:144553679-144553701 TGTTTTTGAGGATTATTTAATGG + Intergenic
981568888 4:146131153-146131175 TTTTTTGGAAGATAACTTACAGG - Intergenic
983264519 4:165494011-165494033 TGGTTTGGGACATAAGTTAAAGG - Intronic
983952184 4:173655083-173655105 TGCTTTGGAAGAAAAGTGAATGG - Intergenic
983962438 4:173770917-173770939 TGTTGTGAAAGATCAGGGAAGGG + Intergenic
984667773 4:182447871-182447893 TGTTCTGGAAGAAAAATTAAAGG + Intronic
985005491 4:185531307-185531329 AGTTTTGGATGTTCAGTTTAGGG - Intronic
985023395 4:185714984-185715006 TGTTTTGGGTTATAAGTTAAAGG + Intronic
986399290 5:7364515-7364537 TTTTTTGGAATATCTGTGAAAGG + Intergenic
986534009 5:8767571-8767593 TCTTTTGGAAGATGAGTTGTGGG + Intergenic
987231978 5:15903561-15903583 TTTTTTGGAATATCCTTTAAAGG + Intronic
987666765 5:20952758-20952780 TGTTTTTAAAGAGAAGTTAATGG - Intergenic
987763736 5:22197621-22197643 TTTTTGTGAAGATCAGTTATTGG + Intronic
988246980 5:28698429-28698451 TGTTTAAGAATATGAGTTAATGG + Intergenic
988294428 5:29336499-29336521 TGTTATAAAAGATCAGATAAAGG + Intergenic
988628934 5:32908358-32908380 TGTTTTGGAAGAGCACATTATGG + Intergenic
989845998 5:46142195-46142217 TGTTTTGTAAAATCTGTGAAAGG + Intergenic
989851559 5:46218732-46218754 TGTTTTGCAGTATCAGTGAAGGG + Intergenic
989959774 5:50398287-50398309 TATTTTGGAAGATAAGTCTAAGG + Exonic
991221276 5:64222384-64222406 TTTGTTGTAAGATGAGTTAATGG - Intronic
992306890 5:75449870-75449892 AGTTTAGGAAGTTCATTTAAGGG - Intronic
993153916 5:84197370-84197392 TGTTTAGGAAGGTGAGTTAGAGG + Intronic
993635302 5:90335757-90335779 TGTTTTGGAAAGTAAGTTAAAGG - Intergenic
993654192 5:90558184-90558206 TGCTTTGTAAGTTCAGTTGAGGG + Intronic
994690697 5:103016042-103016064 TTTTTGGGAGGTTCAGTTAATGG - Intronic
994931532 5:106193217-106193239 TGTTTTGAAAAATGATTTAAAGG + Intergenic
996547003 5:124690521-124690543 TGTTTTGTAAGAGCAGTTTTAGG - Intronic
997335752 5:133108071-133108093 TGTTTTGAAAGAACATTAAATGG + Intergenic
997451976 5:133990995-133991017 TACTGTGGAAGATCAGGTAATGG - Exonic
997459415 5:134041979-134042001 TGTTTTGGGGGATCAGAGAAAGG + Intergenic
997722808 5:136093836-136093858 TGTTCTGGAAAATCAAATAAAGG - Intergenic
998118152 5:139554407-139554429 TGTTTTTGAACTTCATTTAATGG + Intronic
998265651 5:140665702-140665724 TGGTTTGAAAAATCACTTAAAGG - Intronic
999300817 5:150489200-150489222 GGTTTTGGAAGGTCAGTGGAAGG + Intronic
1001318417 5:170661039-170661061 TTTTCTGGAAGATCTGTTCAGGG + Intronic
1002121547 5:177008263-177008285 GGTTTTGGAGGATCAGTTGGAGG - Intronic
1003128213 6:3373061-3373083 TCTTAGGGAAGATCAGTTAGGGG - Intronic
1004039173 6:11959024-11959046 TGTTTTGGAAGTTGAATTATTGG - Intergenic
1004574006 6:16875004-16875026 TTTTTTGGAAGCACATTTAAAGG + Intergenic
1004861193 6:19806052-19806074 TTTTTTGGAATAAAAGTTAAGGG + Intergenic
1009251677 6:61308903-61308925 TGTTTTTGTAGATCTGTGAAGGG + Intergenic
1009259358 6:61464367-61464389 TGTTTTGTAGAATCTGTTAAGGG + Intergenic
1010248051 6:73680522-73680544 TGTTCTGGATGAGCAGTGAAAGG + Intergenic
1010550071 6:77210870-77210892 TTTTTTAAAAGAGCAGTTAATGG + Intergenic
1011276773 6:85639535-85639557 GGTTTAAGAAAATCAGTTAAGGG - Intronic
1011447157 6:87453313-87453335 TGTTCTGCAAGAAAAGTTAAAGG + Intronic
1011806735 6:91080605-91080627 TGTTTTGGCACATCATTTTAAGG + Intergenic
1012367750 6:98463213-98463235 TGTTTTGGAAGATTTATTTATGG - Intergenic
1012615263 6:101269551-101269573 CGTTTTGGAAGATATGTTACTGG - Intergenic
1012847049 6:104403641-104403663 TGTTCTAGAAGATCAGGAAAAGG + Intergenic
1013046112 6:106487812-106487834 TTTTTGGGAGGATCTGTTAATGG + Intergenic
1013328096 6:109068462-109068484 TAATTTGGAAGATAAGTTCAGGG + Intronic
1013454378 6:110316952-110316974 AATTTTGGAAAATCAGTTAAAGG - Intronic
1015187870 6:130439217-130439239 TTCTTTGGAAGACCAGTTAGGGG + Exonic
1015254112 6:131158850-131158872 TGGCTTGGAAGCTCAATTAATGG + Intronic
1016130404 6:140461490-140461512 TGTGTTGGAAAACCAGTTAATGG + Intergenic
1016671197 6:146710476-146710498 TGATTTGGAACATCAGTTTATGG - Intronic
1017510325 6:155108789-155108811 TCTTTTGCAAAATTAGTTAAGGG + Intronic
1017700104 6:157061086-157061108 TGTCTTGGTTGATCAGTTGAGGG - Intronic
1020224321 7:6268098-6268120 TGTTTTGAAAGAGGAGGTAATGG - Intronic
1021328312 7:19302113-19302135 TATTTAGGAAGATCAGGGAAGGG + Intergenic
1022191698 7:28022305-28022327 TTTTCTGGAAAAGCAGTTAAGGG - Intronic
1023936598 7:44744593-44744615 TGTTTTTGAAGAATATTTAATGG - Intergenic
1024461129 7:49660703-49660725 TATTTTGGAAAATAATTTAATGG + Intergenic
1024880205 7:54076625-54076647 TTTTTTGGATGATCAGTTCTTGG - Intergenic
1025532106 7:61900968-61900990 TGTTTTGTAGGATCTGTGAAGGG + Intergenic
1025592002 7:62872731-62872753 TGTTTTGGAAGATCTGCAAAGGG + Intergenic
1026126994 7:67587802-67587824 TGTTTTGGAAGACCTGATCATGG + Intergenic
1026188776 7:68105452-68105474 TGATTTAGATAATCAGTTAAAGG - Intergenic
1030276357 7:107725830-107725852 TGTTTTAGAATAGTAGTTAAAGG - Intergenic
1030626140 7:111848226-111848248 TGATTTGGAAGATAAGGTATGGG - Intronic
1031354299 7:120771186-120771208 TCTTTAGGTAGAACAGTTAAAGG - Intergenic
1032315293 7:130832458-130832480 TGTTTTGTAAGTACACTTAAAGG + Intergenic
1032409074 7:131680464-131680486 TTTTCAGGAAGATCAGTTTAGGG + Intergenic
1035974826 8:4297716-4297738 TGTGTTGGAAGATCATTCAATGG + Intronic
1036137433 8:6174968-6174990 TGTTTTGGAAGCCCAGTTCAAGG + Intergenic
1036205637 8:6803861-6803883 GGTTTTGGAAGAACAGCCAAGGG - Intergenic
1037209263 8:16365735-16365757 TTTTGTTGAAGATCAGTTAGTGG - Intronic
1037545813 8:19920917-19920939 TCTTGTTGAAGATCAGTTGATGG - Intronic
1040123600 8:43710045-43710067 TTTTTTGAAAGATCTGTGAAGGG + Intergenic
1040127857 8:43758932-43758954 TGTTTTGGATAATCTGTGAAGGG + Intergenic
1040129165 8:43774399-43774421 CTTTTTGGAGGATCAGTGAAGGG + Intergenic
1040129982 8:43784130-43784152 TGTTTTGGAAAATCTGCAAAGGG + Intergenic
1040132129 8:43809532-43809554 CTTTTTGGAAGATCTGTGAAAGG + Intergenic
1040132949 8:43818730-43818752 TGTTTTGGCAAATCTGTGAAGGG + Intergenic
1040321047 8:46302869-46302891 TTTTTTGGAGAATCAGATAAGGG - Intergenic
1041519991 8:58745207-58745229 TTTTTTGGCAGATAAGATAATGG + Intergenic
1042517695 8:69676956-69676978 GATTTTGGAAGCTCAGTTAGAGG - Intronic
1042927920 8:73985729-73985751 TGTTTTTGTAGATCTGATAATGG - Intergenic
1043697405 8:83237472-83237494 TGTTTTTGGAGACAAGTTAATGG - Intergenic
1044323721 8:90835932-90835954 TGTTTGATAAGATCTGTTAATGG - Intronic
1047454480 8:124997270-124997292 TGTTATGGAGGATAAATTAAGGG + Intergenic
1047982216 8:130195092-130195114 TGATTTGGAAGTTGAGTAAATGG - Intronic
1050075518 9:1858601-1858623 TTTTTTGGAAGATCTGCTATTGG - Intergenic
1050638297 9:7637619-7637641 TGTTTCGGAAGAACAGACAAAGG + Intergenic
1051995634 9:23213315-23213337 TGTTTTAGACTATCAGTTACAGG - Intergenic
1052021831 9:23533759-23533781 TGCTATTGAAGAGCAGTTAAAGG + Intergenic
1052635610 9:31099857-31099879 AGTTTTGTAACTTCAGTTAAAGG - Intergenic
1053589045 9:39491839-39491861 TGTTCTTTAAGATCAGTTACTGG - Intergenic
1054362768 9:64193259-64193281 TGTTTTGTAGAATCTGTTAAGGG + Intergenic
1054577257 9:66873456-66873478 TGTTCTTTAAGATCAGTTACTGG + Intronic
1054840112 9:69729382-69729404 TATTTTGGAAGATGATTTAAAGG - Intronic
1055119172 9:72638364-72638386 TGAATTGGAAGAGCAGTTAGAGG - Intronic
1055124424 9:72702776-72702798 TGTTTTAGAAGATCTGAGAACGG - Intronic
1056049151 9:82749774-82749796 AGTTTTGAAAAATCAGTGAAAGG - Intergenic
1056157587 9:83854295-83854317 TGTTTTGATAGATCACTGAAGGG - Intronic
1056352958 9:85769788-85769810 TGTTTTGATAGATCACTGAAGGG + Intergenic
1057253244 9:93521068-93521090 AGTTTTGGAAAATCTGTTAGAGG + Intronic
1059809495 9:117839924-117839946 TGTTTTGAAAGTTGAGTTCAAGG - Intergenic
1060841237 9:126794610-126794632 TGTGTCTGCAGATCAGTTAAGGG - Intergenic
1185986486 X:4840712-4840734 TGTTCTAGAAGTTTAGTTAAAGG + Intergenic
1188126150 X:26372151-26372173 TGTTTTGTAAGAACAATTAAAGG + Intergenic
1188724264 X:33562076-33562098 TATTTTGTAAGATCAATTCAAGG + Intergenic
1189831489 X:44978812-44978834 TGTTCTGGAATATCATGTAATGG + Intronic
1190047568 X:47124942-47124964 AGTTTTGGAAGATCAGTGATTGG - Intergenic
1190252300 X:48736457-48736479 TGTTTTGGAATCTCAGTTCAGGG - Intergenic
1191730466 X:64329241-64329263 TGATTTGGAAGATAACTTAGAGG - Intronic
1193242164 X:79183774-79183796 TATTTTTGAGCATCAGTTAATGG + Intergenic
1193761953 X:85477823-85477845 TGTTTTAAAAGATCTGTTTAGGG - Intergenic
1195392556 X:104378104-104378126 TATTTTGGAAAATTAGTTAAAGG + Intergenic
1196697913 X:118634014-118634036 TGACTTGAAAGATCAGTTAAAGG - Intronic
1197300564 X:124774944-124774966 TGTTTTGGAGGATCCTTTGAAGG - Intronic
1201577121 Y:15472809-15472831 TGTCTTGGAAGGTAAGGTAAAGG - Intergenic
1201954478 Y:19607895-19607917 TTTTCGGGAAGTTCAGTTAAAGG - Intergenic