ID: 930217348

View in Genome Browser
Species Human (GRCh38)
Location 2:48710212-48710234
Sequence TAGAAATATACCCAGGGGAT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 186
Summary {0: 1, 1: 0, 2: 1, 3: 12, 4: 172}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
930217348 Original CRISPR TAGAAATATACCCAGGGGAT GGG (reversed) Intronic
902758400 1:18564771-18564793 TTTCAATATACCCAGGGGCTTGG + Intergenic
903908362 1:26703080-26703102 TATAAATAAACCCAGGCCATTGG - Intronic
905032518 1:34896875-34896897 CAGAAATAAACCCAAGGGTTAGG + Intronic
907406221 1:54255124-54255146 TAGAAATCTACACTGGGGCTGGG - Intronic
908899533 1:68940371-68940393 TAGAAATACACTCAGAGGAGGGG - Intergenic
912924339 1:113900721-113900743 TAGAAATATACTGTGGGAATAGG - Intronic
917308214 1:173649512-173649534 TAGAAAAATAGGCAGAGGATAGG - Intronic
918111998 1:181463632-181463654 TAGAAATATGGGCAGAGGATAGG - Intronic
919114435 1:193263093-193263115 AAGAAATTTACCAAGGGGAAAGG - Intergenic
920626699 1:207609483-207609505 TAGAAATACACCGAGGGGGAGGG - Exonic
1068286045 10:54936374-54936396 TAGATATATACCCAAGAGAAGGG - Intronic
1069649975 10:70039441-70039463 TATAACTATATCAAGGGGATAGG + Intergenic
1069650714 10:70045725-70045747 AGGATATATACCCAGAGGATGGG - Intergenic
1070917841 10:80166385-80166407 TACCAAGATGCCCAGGGGATCGG + Intronic
1071142823 10:82531835-82531857 TAGAAATATACTAAGAGGGTAGG - Intronic
1072354320 10:94591649-94591671 GCCAAATATACCCTGGGGATAGG + Intronic
1073237102 10:102026433-102026455 TGGAAATATACACAGAGGAATGG + Intronic
1079725769 11:23879044-23879066 TGGAAATATACACTGGGGAAAGG - Intergenic
1079870501 11:25793050-25793072 TAAAAATTTACCAAGGAGATAGG - Intergenic
1080062344 11:27970389-27970411 AAGCAACATACCCAGTGGATGGG - Intergenic
1086678751 11:89641906-89641928 TTGAAATATACCCATGGGTCAGG + Intergenic
1087296540 11:96382408-96382430 GAGAAATATTCTCATGGGATTGG + Intronic
1088304393 11:108392505-108392527 TAGATATATACCCAAGAGAAGGG - Intronic
1093113034 12:15175678-15175700 TTGAAAAATTCCCTGGGGATAGG + Intronic
1093800696 12:23368216-23368238 TAGAAACATACTCATGTGATGGG - Intergenic
1096288062 12:50317268-50317290 AGGACATATACCCAGGAGATGGG + Intergenic
1098529077 12:71520046-71520068 TAGATATATACCCAAAGGAATGG + Intronic
1101527684 12:105546687-105546709 TAAAAATATCAACAGGGGATTGG - Intergenic
1102721260 12:115018369-115018391 TAGAAACATACCTGAGGGATTGG + Intergenic
1102902289 12:116647702-116647724 CAGAAATGTAGCCAGGTGATTGG - Intergenic
1103213483 12:119183550-119183572 TAGAAATACATCCAGAGGCTAGG - Intronic
1103695580 12:122812899-122812921 AAGAAATATTCACAGGTGATCGG + Intronic
1106745251 13:32697653-32697675 TAGCAAGTTACCCAGGGGACTGG - Intronic
1106787018 13:33117404-33117426 TAGAAATAAACACATGGGCTGGG - Intronic
1108432687 13:50370141-50370163 TGGAAATATACCCAAAGGAATGG + Intronic
1111683453 13:91472338-91472360 TAGAGATAAACCCAGGTGATAGG - Intronic
1114739764 14:25083552-25083574 TAGAAAGGGACTCAGGGGATTGG + Intergenic
1115149115 14:30263069-30263091 TAGAAATAAACCAAGGAGTTTGG + Intergenic
1116313223 14:43353180-43353202 TAGATATATACACAGGGGAAGGG - Intergenic
1116666019 14:47776676-47776698 TTGAAATATACCCAGAAGAAAGG + Intergenic
1117470682 14:56041305-56041327 TGGAAATATACCCTGAGGATGGG + Intergenic
1117522870 14:56568217-56568239 AAGAAAAATAACCAAGGGATAGG - Intronic
1120580071 14:86236152-86236174 TAGATATATACCCAAAGGAAAGG + Intergenic
1121391175 14:93576326-93576348 CAGAAAAATACCTAGGTGATAGG + Intronic
1121661972 14:95641704-95641726 TAAAAATATTCCCAGAGAATGGG - Intergenic
1121744461 14:96277453-96277475 TAAAAATACACCCCAGGGATTGG + Intergenic
1121744712 14:96279072-96279094 TAAAAATACACCCCAGGGATTGG - Intergenic
1123401926 15:19995745-19995767 TAGAAATATACGCAGGCAAGTGG + Intergenic
1123511267 15:21002409-21002431 TAGAAATATACGCAGGCAAGTGG + Intergenic
1124485945 15:30116380-30116402 AAGTAATATTCCCAGAGGATAGG - Intergenic
1124517630 15:30380889-30380911 AAGTAATATTCCCAGAGGATAGG + Intronic
1124541022 15:30585366-30585388 AAGTAATATTCCCAGAGGATAGG - Intergenic
1124757637 15:32422218-32422240 AAGTAATATTCCCAGAGGATAGG + Intergenic
1124893440 15:33754621-33754643 TTAAAATATACCCAGAGGCTGGG + Intronic
1125431322 15:39596779-39596801 TGGAAATATGCACAAGGGATGGG - Exonic
1127476013 15:59333893-59333915 TGGAAATATGCCCAGGTAATAGG + Intronic
1127629182 15:60810536-60810558 GAGAAAAATAAGCAGGGGATGGG - Intronic
1128829125 15:70750392-70750414 TAGAACAATAGCAAGGGGATTGG - Intronic
1133157720 16:3887495-3887517 TAAAAATAAACACAGGGCATGGG - Intergenic
1134164555 16:11919717-11919739 TAGAAAAATTACCAGGGGGTTGG - Intergenic
1134793938 16:17017188-17017210 TAGATATATACCCAAGAGAAAGG - Intergenic
1139048208 16:63089205-63089227 CAAAAATATACCCTGGGGAAAGG - Intergenic
1140901525 16:79372361-79372383 GAGAAATATACCCACTGAATAGG + Intergenic
1140972664 16:80028507-80028529 GAGAAAAATAGCCACGGGATGGG - Intergenic
1140972693 16:80028665-80028687 GAGAAAAATAGCCATGGGATGGG - Intergenic
1143530799 17:7502218-7502240 CAGAATTATACCCTGGGAATAGG - Intronic
1146033289 17:29384967-29384989 AAGAAAAATACCCAGGGATTGGG - Intergenic
1150902948 17:69302388-69302410 TAGCAATATAACCAGGCCATAGG + Intronic
1151669213 17:75562880-75562902 TAGAAATATGGCTAGGGGCTGGG - Intronic
1203199510 17_KI270729v1_random:262738-262760 TAGAAATATATCCAATGGAATGG + Intergenic
1203209110 17_KI270730v1_random:63478-63500 TAGAAATATATCCAATGGAATGG + Intergenic
1155467820 18:26158119-26158141 TAGAAATATACCCAAAGCAATGG + Exonic
1156674869 18:39515294-39515316 GAGAAATAAACCAATGGGATAGG + Intergenic
1157196730 18:45625865-45625887 TAGGAAAATACCCTGGGGAGAGG + Intronic
1159034781 18:63266391-63266413 TGGAAAGATACACAGGGCATGGG + Intronic
1160321210 18:77897558-77897580 CAGAAATATAACCAGGGGAATGG - Intergenic
1160506359 18:79428922-79428944 TAGAAATACACCCAGTGGGCTGG + Intronic
1164983001 19:32628184-32628206 TAGAAAACTACACAGGGGAATGG + Intronic
1165599025 19:37037160-37037182 TTGAAATAAACCCAGGGGAGAGG + Intronic
1166422231 19:42646467-42646489 ATGCAGTATACCCAGGGGATAGG + Intronic
1167789301 19:51662971-51662993 TCAAAATATACCCAGAGGCTGGG + Intergenic
925468597 2:4134818-4134840 TAGAAAAACACCCAGGGGAGAGG - Intergenic
927353741 2:22150421-22150443 AAGAAATTTACCGAGGAGATAGG - Intergenic
930217348 2:48710212-48710234 TAGAAATATACCCAGGGGATGGG - Intronic
931003481 2:57819048-57819070 TAGGAATATTCCCAGGTGTTTGG + Intergenic
931114723 2:59152123-59152145 TAGAAATATAGCCCAGGCATAGG - Intergenic
931221675 2:60294444-60294466 AAGAAATATCTCCAGGGGAAAGG - Intergenic
932045068 2:68340176-68340198 GAGACATATAAACAGGGGATGGG - Intergenic
932920563 2:75909727-75909749 TAGGTATATACCCAAAGGATAGG - Intergenic
932931103 2:76040411-76040433 TAAAAATATACACTGGGGAAAGG + Intergenic
935028422 2:99299220-99299242 AAGAAAAAAACCCAGGGGCTGGG - Intronic
935195192 2:100809567-100809589 TGGAAAGATACCCAAGGGAGTGG - Intergenic
936375629 2:111938827-111938849 TGGAAAGATACCCAAGAGATGGG - Intronic
939451288 2:142377979-142378001 TAGGTATATACCCAAGAGATAGG - Intergenic
943706043 2:191035808-191035830 TGGAAATATACCCTGGAGACTGG + Intronic
944268952 2:197759948-197759970 CAGAAATGTCCCCAGGGGAGTGG + Intronic
948691689 2:239709138-239709160 TAGATATATACCCAAGAGAAAGG - Intergenic
1169602340 20:7275998-7276020 TAAAAAGAGACCCATGGGATGGG + Intergenic
1169955369 20:11097101-11097123 TAAAAATATATACAGGGGAAAGG + Intergenic
1169980222 20:11376343-11376365 TAGAAAGAAACCCAGAGGTTTGG + Intergenic
1171838128 20:30176050-30176072 TTGAAATAGACCCAGGGAAGAGG - Intergenic
1172223168 20:33287439-33287461 AAGAAGTATTACCAGGGGATTGG + Intronic
1181557875 22:23682492-23682514 AACAAATATACCCAGGGGATGGG + Intergenic
1183016757 22:34994809-34994831 TAGAAATAAACCCAGAGCAAGGG - Intergenic
1183040256 22:35172615-35172637 TTGAAAGCTCCCCAGGGGATTGG - Intergenic
949572639 3:5308363-5308385 AAGAAATATACCAAGTGAATAGG + Intergenic
951225119 3:20111887-20111909 AAGAAACATTCCAAGGGGATGGG + Intronic
951365462 3:21776569-21776591 TAGAAAAATAATCAAGGGATAGG - Intronic
954471648 3:50701824-50701846 CAAAAATATACACTGGGGATAGG - Intronic
955736287 3:62042016-62042038 CAGGATTATACCCAGGGAATGGG + Intronic
956056826 3:65307912-65307934 TAGAAATAAATGCAGGGTATAGG + Intergenic
956567516 3:70655770-70655792 TATAAATATACACTGGGAATGGG + Intergenic
958174099 3:89973219-89973241 TAGAAATGAACCCAGAAGATTGG - Intergenic
961598205 3:128036492-128036514 CAAAAACATACCCTGGGGATGGG + Intergenic
962019524 3:131483235-131483257 TAAAAATGTACCCAGGGTAGGGG + Intronic
964494414 3:157272756-157272778 CAGAAAAACACCCAGGGGCTAGG - Intronic
964784319 3:160377832-160377854 TAGACATATACCCAGACCATAGG - Intronic
966149923 3:176856541-176856563 TAAAAATATAAGCAGGGGGTAGG + Intergenic
966961533 3:184944422-184944444 CAGCAATGCACCCAGGGGATGGG - Intronic
967357205 3:188585303-188585325 TAGAAAAATACAAAGGGGAGAGG - Intronic
969503445 4:7569215-7569237 TAGAAATATCCACAGAGGCTGGG + Intronic
970213249 4:13732682-13732704 CAGAAAAATACCCAGGGGGATGG + Intergenic
971905702 4:32722408-32722430 TGGAAATGTACCCAAGGGAAAGG + Intergenic
972273600 4:37536132-37536154 TGGCCATATAGCCAGGGGATAGG + Intronic
972395789 4:38658573-38658595 TAGAGAAATAGCCAAGGGATTGG - Intergenic
972522309 4:39870825-39870847 TAGATATATACCCAAGAAATGGG + Intronic
974343235 4:60641120-60641142 TAGAAATAAAACAAGGGTATTGG - Intergenic
976810814 4:89099596-89099618 TAGAAATTTAACAAGGGGATGGG + Intronic
977660920 4:99584933-99584955 CAGAAATAGGCCCAGGGGTTTGG - Intronic
978274045 4:106927293-106927315 TAGACATATATGCAGGAGATGGG - Intronic
978439120 4:108715187-108715209 AACAAATATACTCAGGTGATAGG - Intergenic
979118651 4:116863452-116863474 AATAACTATACCCAGGGGAGAGG + Intergenic
981143885 4:141302842-141302864 TAGAAAAATATCCAGGGGCTGGG - Intergenic
981989690 4:150902933-150902955 TGGAAATATCCTCAGTGGATAGG - Intronic
982431156 4:155323676-155323698 TAGACATATACATAGGGTATGGG + Intergenic
983315632 4:166129407-166129429 TGGGTATATACCCAGGGGAATGG - Intergenic
983379666 4:166976007-166976029 TAGATATATACCCAGAAGAAAGG - Intronic
984634709 4:182098330-182098352 TAGATATATACCCAAGAGAAAGG + Intergenic
986579988 5:9255810-9255832 AAGGAATATACCCAGGAGAGAGG - Intronic
987134839 5:14890850-14890872 TAACAAGATCCCCAGGGGATTGG - Intergenic
989041737 5:37236308-37236330 TAAAAATATACACTGGGGAAAGG + Intronic
989281052 5:39643818-39643840 TAAAGATATACCCAGGGGGTGGG - Intergenic
990257950 5:53991045-53991067 TGGAATTATACCCATGGGGTGGG - Intronic
990771798 5:59255056-59255078 TAGGAATATACCCAGAAGAAAGG + Intronic
993841318 5:92883256-92883278 AAGAAATATTCCAAGGAGATAGG - Intergenic
997521219 5:134525669-134525691 CAGAAACATACACAGGGGGTTGG + Intronic
1003456721 6:6289845-6289867 TAGAAATTGACCCAGGGGAATGG - Intronic
1004322506 6:14643249-14643271 TTAAAATATACCCTGAGGATAGG + Intergenic
1005224510 6:23626218-23626240 CAGCAATATACCCTGGGGAAAGG - Intergenic
1006553116 6:34841362-34841384 TAGAAATATAGACTGGGGCTGGG - Intronic
1013422389 6:109978517-109978539 GAGAAAGATATCCAGGGGACAGG + Intronic
1013687779 6:112605489-112605511 TAGAAATATACCCAAAAGAAAGG + Intergenic
1016166503 6:140951958-140951980 TTGAATTATATCCAGGGGTTTGG - Intergenic
1021057752 7:16071748-16071770 TAAAAATATACCATGAGGATTGG - Intergenic
1021288384 7:18811911-18811933 TTGATATATTCACAGGGGATTGG + Intronic
1023689914 7:42774975-42774997 TAGAAATAGATGCAGAGGATGGG + Intergenic
1024333143 7:48176741-48176763 TAGAGATCTACCCTGGGGCTAGG + Intronic
1028632147 7:92946754-92946776 TAGATATATACCCAAAGGAAAGG - Intergenic
1031142522 7:117960012-117960034 TAGAAATAAAACCAAGGGAATGG - Intergenic
1032162440 7:129521099-129521121 TAAAAATATACACAGGAGCTGGG + Intergenic
1032999387 7:137486672-137486694 TAGAAATAAATTCAGGGGAGAGG - Intronic
1034878173 7:154743659-154743681 TTGGTATATACGCAGGGGATTGG + Intronic
1038356126 8:26831053-26831075 AAGAAATATACTTAGGAGATTGG + Intronic
1038898140 8:31810773-31810795 TAGAAACATGACCAGGGTATGGG + Intronic
1039084544 8:33766982-33767004 TAGATATATACCCAAGAGAAGGG + Intergenic
1041364526 8:57087397-57087419 GAGAAATATGTCCAGGGCATTGG + Intergenic
1043876652 8:85493327-85493349 TAGAAATGTGCACGGGGGATGGG + Intergenic
1044388560 8:91620699-91620721 TAAAAAAATCCCCAGGTGATAGG - Intergenic
1045748691 8:105455879-105455901 TGGTAATATAGCCAGGGGCTTGG + Intronic
1048429320 8:134354237-134354259 CAGAAATATACACTGGGGAAAGG - Intergenic
1049197053 8:141321458-141321480 TAAAAATATACCTAAGGGCTGGG + Intergenic
1050589391 9:7146969-7146991 CAGGAATATACCTAGAGGATAGG - Intergenic
1051520451 9:17981348-17981370 TAAAAATATTTCCAGGGAATAGG - Intergenic
1057047308 9:91896256-91896278 TACAAATATACCCAGTGGAGCGG - Intronic
1059416277 9:114164475-114164497 TAGAAACCCACCCAGTGGATAGG + Intronic
1059557431 9:115295401-115295423 TAGATAAATACCCAGAGGCTTGG + Intronic
1061065812 9:128276746-128276768 AAGAAATACTCACAGGGGATCGG - Exonic
1187116275 X:16355165-16355187 TAGAAATATAACCAGAGAAGAGG + Intergenic
1189602588 X:42642983-42643005 TAGCAACAAACCCAGAGGATGGG + Intergenic
1190938330 X:55016293-55016315 TAGAAATATACAAAAGGGATAGG + Intronic
1191205484 X:57828959-57828981 TATTAATATACCTTGGGGATGGG - Intergenic
1197052053 X:122071616-122071638 TAGGAATATACCCAGAAGAAAGG - Intergenic
1197077173 X:122365671-122365693 TAGAAATAGACAAAGGGGAGGGG - Intergenic
1198150312 X:133902017-133902039 TTGAACTTTACCCAGGGGTTGGG + Intronic
1199316472 X:146384538-146384560 TAGAAAAATACCAAGAGAATTGG - Intergenic
1199870484 X:151894070-151894092 AAGAAAGATAGACAGGGGATTGG - Intergenic