ID: 930217577

View in Genome Browser
Species Human (GRCh38)
Location 2:48712351-48712373
Sequence CTTCAAACACAGCTGATGCT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 176
Summary {0: 1, 1: 0, 2: 1, 3: 21, 4: 153}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
930217575_930217577 -2 Left 930217575 2:48712330-48712352 CCCTCAAAATACAGCATGTTTCT 0: 1
1: 0
2: 3
3: 44
4: 370
Right 930217577 2:48712351-48712373 CTTCAAACACAGCTGATGCTTGG 0: 1
1: 0
2: 1
3: 21
4: 153
930217574_930217577 -1 Left 930217574 2:48712329-48712351 CCCCTCAAAATACAGCATGTTTC 0: 1
1: 1
2: 3
3: 21
4: 252
Right 930217577 2:48712351-48712373 CTTCAAACACAGCTGATGCTTGG 0: 1
1: 0
2: 1
3: 21
4: 153
930217573_930217577 0 Left 930217573 2:48712328-48712350 CCCCCTCAAAATACAGCATGTTT 0: 1
1: 1
2: 1
3: 26
4: 245
Right 930217577 2:48712351-48712373 CTTCAAACACAGCTGATGCTTGG 0: 1
1: 0
2: 1
3: 21
4: 153
930217576_930217577 -3 Left 930217576 2:48712331-48712353 CCTCAAAATACAGCATGTTTCTT 0: 1
1: 0
2: 5
3: 42
4: 354
Right 930217577 2:48712351-48712373 CTTCAAACACAGCTGATGCTTGG 0: 1
1: 0
2: 1
3: 21
4: 153

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
930217577 Original CRISPR CTTCAAACACAGCTGATGCT TGG Intronic
901314311 1:8295468-8295490 CGTCAGGCACAGCTGCTGCTGGG + Intergenic
901783847 1:11611757-11611779 CTTCAGACACAGCTGAATCCAGG + Intergenic
903122321 1:21224401-21224423 CTTCAAACACAGCCCCTGCTAGG + Intronic
904470906 1:30735602-30735624 CTCGAAACAGAGCTGATGGTGGG + Intronic
905529185 1:38663068-38663090 CATCAAACACATTTGATGATTGG + Intergenic
907492804 1:54819664-54819686 CTTCAAAAACAGGTGAGGCCGGG - Intronic
907606546 1:55823440-55823462 CTTCAAACACCGATATTGCTGGG - Intergenic
907680655 1:56560362-56560384 TACCAAACATAGCTGATGCTGGG + Intronic
908458108 1:64323755-64323777 CTTCAAGGACAGCTGAGGGTAGG - Intergenic
908597505 1:65704154-65704176 CTTGAAACACAGCTGGTATTAGG - Intergenic
908648993 1:66311627-66311649 CTTCAGAGACTGCTGCTGCTGGG - Intronic
909461377 1:75919142-75919164 CTTCAGACACAGCTGAGTTTAGG - Exonic
911227819 1:95326446-95326468 CTTCAAATACAGCTCATCTTTGG - Intergenic
918967412 1:191369485-191369507 TTTCAAACACTGCTGAGGCCAGG + Intergenic
921591179 1:217005443-217005465 TTTCAATCACAACTGTTGCTTGG + Intronic
922699271 1:227749114-227749136 ATCCAAACACAGAAGATGCTCGG - Intronic
1065120568 10:22526101-22526123 CTTGTAAGACTGCTGATGCTGGG + Intergenic
1067177588 10:43960888-43960910 CTCCAAACACAGATGGTCCTGGG + Intergenic
1067929033 10:50541025-50541047 CTTCAATCAGAGCTGAATCTTGG - Intronic
1068730155 10:60349005-60349027 CTTCAAGTACAGTTCATGCTGGG - Intronic
1070236881 10:74637508-74637530 CTTCCAGCATAGCTGATGGTTGG - Intronic
1072643029 10:97227990-97228012 CTTCAAAAATAACTTATGCTTGG + Intronic
1073568993 10:104560133-104560155 CAGCAAACACAGATGAGGCTGGG - Intergenic
1075099264 10:119494444-119494466 CTTCACACACAGCTGGAGCCAGG - Intergenic
1075881517 10:125856031-125856053 CCTCAAGCACAGCTGATACAGGG + Intronic
1077375118 11:2202155-2202177 CTCCAAACCCAGCTCATGCCAGG + Intergenic
1078308134 11:10211539-10211561 CTAAAGACACAGCTGATGATGGG - Intronic
1080923562 11:36732891-36732913 CCTCAAAGACAGCAGATACTTGG - Intergenic
1081871547 11:46384809-46384831 CTTCCAGCACTGCTGATGGTTGG + Intergenic
1084514157 11:69626943-69626965 CTGCAAACACTCCTGAGGCTGGG - Intergenic
1085006068 11:73091742-73091764 TTTAAAACCTAGCTGATGCTGGG + Intronic
1087151913 11:94867194-94867216 CTTCAAACACAGATTCTGGTTGG - Intronic
1087218192 11:95517665-95517687 ATTCAAGCACAGCTGTTGCTGGG + Intergenic
1089482815 11:118820826-118820848 CTCCCAGCACAGCTAATGCTTGG + Intergenic
1091194889 11:133722086-133722108 CTTCAAACACAGCTGGTTCTAGG - Intergenic
1093070397 12:14702179-14702201 CTGCAAATACAGCTGCTTCTGGG + Intergenic
1094140464 12:27175623-27175645 CTTTAAACACAGCTCTTGCTGGG + Intergenic
1099466598 12:82995588-82995610 CTTCAAACACAGTTAATTCTGGG + Intronic
1099517599 12:83616848-83616870 CTTGAAAAACAGCAGATGCAAGG - Intergenic
1102977701 12:117218415-117218437 CTGGAAACACCGCTGCTGCTTGG + Intronic
1103968117 12:124652944-124652966 CTGCAAAGACAGCTGCTGCCAGG - Intergenic
1110415699 13:75249672-75249694 CTTCAGATACATCTCATGCTTGG - Intergenic
1112306629 13:98280283-98280305 CTGGAAAACCAGCTGATGCTGGG - Intronic
1112643855 13:101306992-101307014 CTTCAAACCCAGCCTATGCTTGG - Intronic
1114187839 14:20416511-20416533 CTTCAAAAACTACTGATGCCTGG - Intergenic
1114847305 14:26338606-26338628 CTTCCTTCACAGCTGATGGTTGG - Intergenic
1118813201 14:69290445-69290467 CACCAAACACAGATGATTCTGGG - Intronic
1122398431 14:101451607-101451629 CTTCAAACCCAGGGGATGCTGGG + Intergenic
1122478244 14:102027315-102027337 CTGCACACACATCTGTTGCTGGG - Intronic
1122723965 14:103738528-103738550 CTTGAAAGACAGCTGTTGCCAGG - Intronic
1125553513 15:40565504-40565526 CTTAGAACACAGCAGGTGCTTGG - Intergenic
1126150728 15:45522082-45522104 CTTCAAACTCAGCTGACTGTTGG + Exonic
1127023349 15:54775709-54775731 CTGCAACCCCAGCTGCTGCTGGG - Intergenic
1127568552 15:60217280-60217302 ATTTACACACAGCTGAGGCTGGG - Intergenic
1128609872 15:69064978-69065000 CTCCAAACACTGATGATCCTGGG + Intergenic
1129520737 15:76184529-76184551 CTTCAAACCCATCTGCTGTTGGG - Intronic
1131586475 15:93700781-93700803 CTTCAAATACAGTTGTTGTTGGG - Intergenic
1131875207 15:96798655-96798677 CTTCAAACTCAGCTTCTGGTTGG - Intergenic
1136398752 16:30006626-30006648 CTTCACACACGTCTTATGCTTGG + Exonic
1136901311 16:34041231-34041253 CTTAGAATACACCTGATGCTGGG - Intergenic
1139191665 16:64870978-64871000 CTTCAAACACATGGGATGCAGGG - Intergenic
1139963303 16:70730259-70730281 CTTGAAAGACAACTGTTGCTGGG - Intronic
1143813033 17:9487973-9487995 CTTCAAAAACTACTGATGCTTGG + Intronic
1146471024 17:33125046-33125068 CTGTAAACACAGATGAAGCTTGG + Intronic
1147207732 17:38850274-38850296 CGTCAAACACAGAAGATCCTTGG + Intronic
1148207738 17:45790137-45790159 CTTCAAGCTCAGCTGATGGCTGG - Intronic
1149464271 17:56862601-56862623 CTTCAAAATCAGCTGATATTAGG - Exonic
1157201784 18:45665599-45665621 ATTCAAACACAGATTATGCATGG + Intronic
1164938039 19:32230183-32230205 TTTCCCCCACAGCTGATGCTCGG - Intergenic
1166353518 19:42213029-42213051 CTTGAAAAACAGCTGATTCTAGG + Intronic
925192581 2:1897367-1897389 CTTCCAGCACAGAGGATGCTTGG + Intronic
926782291 2:16484461-16484483 CTATAAACACATCTGAGGCTGGG - Intergenic
927316702 2:21691412-21691434 CTTCAGACACAGGAGAAGCTAGG + Intergenic
927744829 2:25609011-25609033 CTCCAAACACCACTGATGCTGGG - Intronic
929571506 2:43025903-43025925 CTTCAAAGTCAGCTGAGCCTGGG + Intergenic
929606303 2:43236540-43236562 CTTAAAACACACTTGTTGCTTGG - Intronic
930217577 2:48712351-48712373 CTTCAAACACAGCTGATGCTTGG + Intronic
931870209 2:66448303-66448325 TTTAAAACACAGCTGTGGCTGGG + Intronic
932901321 2:75704088-75704110 GTTCTCACACAGCAGATGCTGGG + Intronic
933413604 2:81955744-81955766 CTTCAAACACACTTGCTGGTTGG + Intergenic
935310356 2:101777215-101777237 CCTCACACAAAGCTCATGCTTGG - Intronic
937033106 2:118757337-118757359 CTTTAAAGACTGCTGAGGCTGGG + Intergenic
942668737 2:178350918-178350940 CTTAAAACTCTGTTGATGCTTGG - Intronic
944819447 2:203415301-203415323 TTTCAAAGACTGCTGATGCCTGG - Intronic
946493776 2:220175268-220175290 CTTCAAAGACTTCAGATGCTGGG + Intergenic
1169431097 20:5537306-5537328 TTTGAAATACAGCTGATGCGGGG + Intergenic
1169875703 20:10294927-10294949 CTTCACACACAGTTGATGAAGGG - Intronic
1170446635 20:16434876-16434898 CTACAAACACAGCAGATGTCTGG + Intronic
1173348924 20:42226833-42226855 CTTCACACATAGCTCCTGCTTGG - Intronic
1174795298 20:53517306-53517328 CTGTAAACACAGATGAAGCTTGG - Intergenic
1179941447 21:44641061-44641083 CTGCATCCAGAGCTGATGCTGGG - Intronic
1184135150 22:42544284-42544306 TTACAAATACAGCTGATCCTGGG + Intergenic
1184590682 22:45480795-45480817 CCTCCAACACAGTTGATGCATGG - Intergenic
949515720 3:4805173-4805195 CTTCAGGCACAGCTGATACAGGG + Intronic
949690655 3:6633743-6633765 CTGCAAACACAGCTGTAACTAGG + Intergenic
950252171 3:11474982-11475004 CTTCAAACACAACATAAGCTAGG - Intronic
952238090 3:31501059-31501081 CCTCAAAGACTGCTGATGTTTGG + Intergenic
953031529 3:39183099-39183121 CTTCCCACACTGCTGTTGCTAGG + Intergenic
953860703 3:46541861-46541883 CCTCAAGCACAGCTGAGGCAGGG + Intronic
954709473 3:52498212-52498234 CTTCCCACAGAGCTGCTGCTGGG - Intronic
956300850 3:67770890-67770912 TTTAAAACAAAGGTGATGCTGGG - Intergenic
957655052 3:83063376-83063398 CTGCAAACACAGCCCATACTGGG + Intergenic
958464028 3:94436470-94436492 AGTAAAACACAGCTGTTGCTGGG - Intergenic
962704980 3:138034306-138034328 CTTCAGACACAGCTGAATCAAGG + Intergenic
964640698 3:158907065-158907087 CTTCAAACACAGATGAGGACTGG + Intergenic
969038861 4:4277892-4277914 CTACAAACACAGGGTATGCTGGG + Intronic
969670183 4:8585865-8585887 CCACAAACACAGCAGCTGCTGGG - Intronic
970653470 4:18203447-18203469 CCTCAAATACTGCTGAGGCTAGG - Intergenic
972764650 4:42141277-42141299 CTCCAAATAGAGCTGAGGCTTGG - Intronic
973314788 4:48748654-48748676 CCTGACACACAGTTGATGCTTGG - Intronic
974281024 4:59793637-59793659 CGTGAAACACAGCAGATGATTGG + Intergenic
981240540 4:142471654-142471676 CTGCCTACACTGCTGATGCTGGG - Intronic
983200329 4:164854074-164854096 CTGCAAAAACAGCTAATGTTTGG - Intergenic
988720969 5:33878755-33878777 CTTTAAAAAATGCTGATGCTGGG + Intronic
989102065 5:37832851-37832873 CTTTAAAGACTACTGATGCTAGG - Intronic
992013490 5:72553779-72553801 CTACAAACATGGCTGATCCTTGG - Intergenic
993363620 5:87007677-87007699 CTTAAAACACAGTTGAGGCTGGG - Intergenic
993912704 5:93703907-93703929 GTTCAAACAGAGCTGCTGATAGG - Intronic
994071393 5:95607142-95607164 CTTAAAACATGGCAGATGCTTGG - Intergenic
997743014 5:136274158-136274180 AGTCAAACACAGCTCATGCTGGG - Intronic
999588208 5:153114913-153114935 CTTCATGCACAGCTCATGATAGG + Intergenic
1000855065 5:166387995-166388017 CTTTAAACAAAGTTGAGGCTGGG + Intergenic
1001769734 5:174284616-174284638 CTTCAAATACAACTGCAGCTTGG + Intergenic
1002060908 5:176625555-176625577 ATTCAAACCCAGCTGAGGCTGGG + Intronic
1003079574 6:3010463-3010485 TTTCCCACACAGCTGGTGCTGGG - Intronic
1004952225 6:20686314-20686336 CTGTAAACACAGATGAAGCTTGG - Intronic
1005051251 6:21685874-21685896 CTGTAAACACAGATGAAGCTTGG - Intergenic
1005893600 6:30160137-30160159 CTTCAGACACACCTGATCCATGG + Intronic
1010277275 6:73983964-73983986 AATCACACAGAGCTGATGCTGGG - Intergenic
1018073782 6:160191376-160191398 CTAGAATCACAGCTGATCCTAGG - Intronic
1018747216 6:166771963-166771985 CCTCCAACACAGCTGATGAGCGG + Intronic
1024218862 7:47271948-47271970 CATCAATCACATCTGATGATTGG - Intergenic
1026316025 7:69228396-69228418 CTGCAAATACAGATGAAGCTTGG + Intergenic
1028124708 7:87099388-87099410 CTTCAAAACCAGCTGAGGCTAGG - Intergenic
1028484127 7:91339818-91339840 CTTCAAAGACAGCTAATGGATGG - Intergenic
1030348736 7:108459793-108459815 CTTCAAACCCAGCTGAGGACTGG + Intergenic
1032388024 7:131538066-131538088 CTTCAAACACATCTGTGGCAAGG + Intronic
1033463883 7:141573018-141573040 CTTCATCCACAGCTGAAGGTAGG + Intronic
1033791344 7:144795736-144795758 CTTCAAAGACACCTGATGGTGGG - Intronic
1034051000 7:147984511-147984533 ATTCAATCAGAGCTGATGTTAGG + Intronic
1034144473 7:148856589-148856611 CTGCAGAAACAGCTGATTCTAGG + Intronic
1034541691 7:151762590-151762612 CCCCAAACACAGAGGATGCTTGG - Intronic
1035850887 8:2918373-2918395 CTTCAGACACAGCCAATGCTAGG - Intergenic
1036582372 8:10087305-10087327 CTTCTACCACAGCTCATGCATGG + Intronic
1037336679 8:17799160-17799182 CTTGAAATACAGTTGATGGTTGG - Intronic
1037449176 8:18999453-18999475 GTGCAAACACAACTGATTCTTGG - Intronic
1038863630 8:31414846-31414868 CTGTAAATACAGATGATGCTTGG + Intergenic
1042835003 8:73071779-73071801 CTACACACACAGAGGATGCTGGG - Exonic
1043389745 8:79781037-79781059 CTTCAAAAACTACTGATGCCTGG - Intergenic
1045185448 8:99832501-99832523 CTTCAGAAACAGATCATGCTGGG + Exonic
1047690999 8:127354631-127354653 CCTGAAACACAGCTGACACTCGG - Intergenic
1049950839 9:642154-642176 CTTCTGACACGGCAGATGCTGGG + Intronic
1051009731 9:12396765-12396787 CTTTAAGCACAGCTGAGTCTAGG + Intergenic
1051798603 9:20905216-20905238 CTTCAACCACAGCTGAAGGTGGG - Intronic
1055483144 9:76730118-76730140 GAGCAAACACAGCTGATACTTGG + Intronic
1055700462 9:78939365-78939387 TTACAATCCCAGCTGATGCTAGG - Intergenic
1057617892 9:96608292-96608314 TAACAAACACAGCTGAGGCTGGG - Intronic
1058221374 9:102308043-102308065 TTTCAAACACAGCAGATGGTTGG + Intergenic
1059671457 9:116496311-116496333 CTTCAAACTGAGCTGATGGCTGG + Intronic
1059974714 9:119703068-119703090 ATTAAAACAGAGTTGATGCTAGG - Intergenic
1061515156 9:131085501-131085523 CTGCAAACCCGGCTGAGGCTGGG - Intronic
1187798893 X:23037471-23037493 CCTAAAACACAGCTCATGGTAGG + Intergenic
1188002735 X:24997490-24997512 CTTCAAAAAGAGATGCTGCTGGG - Intergenic
1188323362 X:28768291-28768313 CTATAAACACATCTGCTGCTTGG + Intronic
1188404915 X:29796138-29796160 CTTCATACATAGCTGATTATAGG - Intronic
1189019486 X:37319754-37319776 CATCAAACTCAGCTAATGCCTGG + Intergenic
1190827310 X:54029407-54029429 CCTCACACACAGCGTATGCTGGG + Intronic
1192484871 X:71516365-71516387 ATTCAAAAACAGCTCAGGCTGGG - Intronic
1193878434 X:86893072-86893094 CATCAAAAATAGCAGATGCTGGG - Intergenic
1197697625 X:129567827-129567849 CTTCAAAAAATACTGATGCTTGG + Intronic
1199819973 X:151435039-151435061 CTTCAAAAACTACTGATGCTGGG + Intergenic
1202232968 Y:22673956-22673978 CTTGAAACACATCTGCTGCTCGG + Intergenic
1202310188 Y:23522202-23522224 CTTGAAACACATCTGCTGCTCGG - Intergenic
1202340090 Y:23855117-23855139 TTTCAATCACAGCTAAGGCTTGG - Intergenic
1202530676 Y:25814965-25814987 TTTCAATCACAGCTAAGGCTTGG + Intergenic
1202560613 Y:26148391-26148413 CTTGAAACACATCTGCTGCTCGG + Intergenic