ID: 930218541

View in Genome Browser
Species Human (GRCh38)
Location 2:48722168-48722190
Sequence CCCAGGATGCTGCTTCTGAA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 267
Summary {0: 1, 1: 0, 2: 2, 3: 26, 4: 238}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
930218537_930218541 27 Left 930218537 2:48722118-48722140 CCAGCCTGGTGACAGAGCGAGAC 0: 1887
1: 8201
2: 11579
3: 11205
4: 8220
Right 930218541 2:48722168-48722190 CCCAGGATGCTGCTTCTGAATGG 0: 1
1: 0
2: 2
3: 26
4: 238
930218538_930218541 23 Left 930218538 2:48722122-48722144 CCTGGTGACAGAGCGAGACTCAG 0: 41
1: 1498
2: 7048
3: 13246
4: 15154
Right 930218541 2:48722168-48722190 CCCAGGATGCTGCTTCTGAATGG 0: 1
1: 0
2: 2
3: 26
4: 238

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
930218541 Original CRISPR CCCAGGATGCTGCTTCTGAA TGG Intronic
900086354 1:899640-899662 ACCAGGATGCTGATTCTGAAAGG + Intergenic
900189057 1:1345641-1345663 CCCAGGGCGCTGCCTCTGAGTGG - Intronic
900977467 1:6026432-6026454 CCCAGGTACCTGCTCCTGAACGG - Intronic
905415064 1:37798363-37798385 CCCACGATGCTACTTAAGAATGG + Intronic
905460304 1:38118516-38118538 CCCAGGGTGCTGCCTCTGACAGG + Intergenic
905481403 1:38264503-38264525 CCCAGGCTGTTGCTTCAGGAAGG - Intergenic
906584672 1:46965845-46965867 CCCAGGATGGAGCTCCTGAGGGG - Intergenic
906963221 1:50432115-50432137 GCCAGAATTCTGGTTCTGAAGGG - Intergenic
907497992 1:54857917-54857939 CCCAGAATGCAGCTTGTTAAGGG + Intronic
907805719 1:57817497-57817519 CCCAGGCAGCTCCTCCTGAAAGG - Intronic
908951876 1:69569831-69569853 CCCAGGAATCGGCTTCAGAAAGG + Intronic
910035417 1:82782428-82782450 CCCTGGATGCTGCATCTAAGGGG - Intergenic
910304449 1:85746725-85746747 GCCAGGTTGCTGCTTCTGCCTGG - Intronic
910806421 1:91193223-91193245 CTCAGGAGGCTGCGGCTGAAGGG + Intergenic
911054173 1:93696604-93696626 CCCAGAGTGATGTTTCTGAAAGG + Intronic
911353041 1:96779094-96779116 TCCAGTATGCTGCTTCTCACTGG + Intronic
915412123 1:155709475-155709497 CCCAGTATGATGATTGTGAATGG + Intronic
915895787 1:159809662-159809684 CCCAAGAAGCTGTCTCTGAAGGG + Exonic
917767200 1:178233829-178233851 TCCAGGATGCTGAATCTAAAAGG + Intronic
917966571 1:180182787-180182809 GCCAGGCTCCTGCTGCTGAATGG + Intronic
919081778 1:192875846-192875868 CCAAGCATGCAGCTTCAGAAGGG + Intergenic
919657147 1:200208314-200208336 CCTAGGGTGCTGCTTTTGACTGG - Intergenic
921252039 1:213307348-213307370 GCCAGGATGCAGGTTTTGAAGGG + Intergenic
921907623 1:220511952-220511974 CTCAGGTTACTGCTGCTGAAAGG + Intergenic
922460025 1:225808805-225808827 CCCAGACTGCAGGTTCTGAAAGG + Intergenic
1066318654 10:34277081-34277103 CCCAGAATGAGGCTTCTGGATGG - Intronic
1067925815 10:50507001-50507023 CCCAGAATGCTGGTACCGAATGG + Intronic
1068446142 10:57126133-57126155 CCGAGGCTTCTGCTTCTCAAGGG + Intergenic
1070321326 10:75356850-75356872 CCCGGGAGGCTGCTGTTGAATGG + Intergenic
1070663932 10:78330154-78330176 GCCAGGAGGCAGCTCCTGAATGG + Intergenic
1071514694 10:86289482-86289504 CCCAGGATGCTGCCTCTCGGTGG + Intronic
1073125630 10:101147061-101147083 CCCAGGGTGCTTCTCCTCAACGG - Intergenic
1073453523 10:103623167-103623189 CCCAGGAAGCACCTGCTGAACGG + Intronic
1075356441 10:121781315-121781337 ACCAGGCTGCTGCATCAGAAAGG - Intronic
1076398570 10:130160952-130160974 CCCTGCATGCTGTTTATGAAAGG + Exonic
1076523516 10:131095456-131095478 CTCAGGAGGCTGCTTCTAAGAGG + Intronic
1076616831 10:131760606-131760628 GCCAGCGGGCTGCTTCTGAACGG + Intergenic
1077462773 11:2718922-2718944 CCCAGGAATCTGCATTTGAATGG - Intronic
1079954436 11:26845116-26845138 TCCAGGATGGTGCTTCAGTATGG + Intergenic
1080962861 11:37180641-37180663 CCCAGGATGCTGCTTCTCCCTGG - Intergenic
1084419169 11:69051785-69051807 CTCAGGCTGCTGCTTCTGCCAGG - Intronic
1084781204 11:71409660-71409682 GCCAGGCTGTTGCTTCTGGAAGG + Intergenic
1089049117 11:115530797-115530819 CCCAGGCTGCTCCTTCTTGAGGG + Intergenic
1089098922 11:115943967-115943989 CAGAGGAGGCTGCCTCTGAAGGG + Intergenic
1089735922 11:120550233-120550255 CCCAGGTTGCTGCTGCCGCAGGG + Intronic
1090095680 11:123740416-123740438 TCCAGGAAGCTACTTCAGAAAGG - Exonic
1091034150 11:132218105-132218127 CCCCGGATGCTGGTGCTGACAGG - Intronic
1091700334 12:2654844-2654866 ACCGGGATCCTGCTTCTGACAGG - Intronic
1091757883 12:3067135-3067157 CCCAGGAAGCTGCTTCTCCCTGG - Intergenic
1092275326 12:7056489-7056511 CCCAGGCCGCAGCTTCGGAAGGG + Intronic
1093987259 12:25549631-25549653 CCCAGAATTCTGCTTTTCAAAGG + Intronic
1096111179 12:49030302-49030324 CCAAGGATGCTGCCTCTGCCCGG - Exonic
1097315529 12:58167051-58167073 CCCAGGAAGTTGCTTCTCACTGG + Intergenic
1099846592 12:88035458-88035480 GCCAGGAAGCCGCTTCTGGACGG + Exonic
1102097162 12:110249855-110249877 TCCAGTATGCTGCTCCTGCACGG + Intergenic
1102367416 12:112350467-112350489 CCCAAGAATCTGCTTCTGAGAGG + Intronic
1102508955 12:113401700-113401722 CTCAGGCTCCTGCTTCTGGATGG + Intronic
1103215112 12:119195751-119195773 CCCAGGAGGCAGCTGCTGACAGG + Intronic
1103794095 12:123491420-123491442 CCCAGGATGCTGCCTCCCTAAGG - Intronic
1104549787 12:129745925-129745947 TCCAGGATTCTCCTTCCGAAGGG - Intronic
1106370670 13:29129745-29129767 CCCAGCATGCTGGTTCTCAGGGG + Intronic
1107766199 13:43737483-43737505 CACAGAATGCTGCTTCTGTTTGG + Intronic
1107883949 13:44858424-44858446 CCCAATATGCTGCTGATGAATGG + Intergenic
1108479431 13:50853566-50853588 CCAAGGAGTTTGCTTCTGAATGG - Intergenic
1112294117 13:98171376-98171398 CCCAGGAGGCTCATGCTGAATGG - Intronic
1117233761 14:53749958-53749980 CCCACTGTGCTGCTTTTGAAAGG - Intergenic
1117782777 14:59251815-59251837 GGCAGGGTGCTGCTTTTGAAGGG + Intronic
1119205992 14:72793903-72793925 CCCACCTTGCTGCTTCTGGATGG + Intronic
1120691996 14:87603095-87603117 CCCAGGATGTTGACACTGAAAGG - Intergenic
1121405183 14:93715534-93715556 GCGAGGAGGCTGCCTCTGAAGGG + Intergenic
1122424069 14:101595543-101595565 GTCAGGTTGCAGCTTCTGAATGG + Intergenic
1122860950 14:104582165-104582187 CCCAGGCTGCTGCCTCTGCCTGG - Intronic
1124238862 15:28013677-28013699 CCCAGGAGTGGGCTTCTGAAAGG - Intronic
1124402559 15:29362236-29362258 CCCTGATTGCTGCTTCTGACTGG - Intronic
1126774708 15:52090456-52090478 CCCAGGATAATGATACTGAAGGG + Intergenic
1127331435 15:57943834-57943856 CCCAGGGTGCTGCCTCAGAAGGG - Intergenic
1127834478 15:62779604-62779626 GCCAGGATGCTGGAGCTGAAGGG - Intronic
1129536976 15:76321517-76321539 CCCAGGGCGCTGCTTCTGGGTGG + Intergenic
1130320237 15:82835498-82835520 CCCAGGCTGCAGCTGCTGAAAGG - Exonic
1133002503 16:2858337-2858359 CCCAGGATGTGGCCTCTGGAAGG + Intergenic
1135554097 16:23421048-23421070 CCCAAAATGCTGTTTCTGAATGG + Intronic
1135794979 16:25433066-25433088 CCCAGGATGCTGCACTTGGATGG - Intergenic
1137497869 16:48984643-48984665 CCCAAGATGTTGCTTCTGCTGGG + Intergenic
1138201913 16:55095332-55095354 CCCAGGCTGGTGTTTCTGCATGG + Intergenic
1138333436 16:56233730-56233752 CCCATGGAGCTGCTTTTGAAGGG + Intronic
1138341958 16:56295817-56295839 CCCAGGTTTCTGATTCAGAAAGG - Intronic
1138401533 16:56748923-56748945 CCCGGGAGGCTGCTTCTGAAAGG + Intronic
1138912739 16:61421946-61421968 CCCAGGATGCTGAGGCTGAAGGG + Intergenic
1139356617 16:66370780-66370802 CCCAGGCTGTTCCTTCTGACTGG - Intronic
1140801443 16:78491926-78491948 CCCAGGGTGCTGCTTGTTGATGG + Intronic
1141659660 16:85435224-85435246 CCCAGGAGGCTGCTCCATAAAGG - Intergenic
1143291678 17:5836149-5836171 CCCTGGATTCTGTTTGTGAAAGG + Intronic
1143631295 17:8141889-8141911 CCGAGGCTGCTGCTTCTGCATGG + Exonic
1147564733 17:41529122-41529144 CCCAAGAAGCTGGTTCTGAGAGG - Intergenic
1148178518 17:45586826-45586848 CCAAGGATGCTGTGTCTGTACGG + Intergenic
1148270637 17:46259629-46259651 CCAAGGATGCTGTGTCTGTAGGG - Intergenic
1149003224 17:51778352-51778374 CACAGCATGCTGGGTCTGAAGGG - Intronic
1150470269 17:65431332-65431354 CCCATGAAGGTGCTTCTGATTGG - Intergenic
1150638413 17:66932816-66932838 CCCAGGATGGTGTCTGTGAAGGG - Intergenic
1151257166 17:72886830-72886852 ACCCGGATGCTCCTTCTGACTGG + Intronic
1152081912 17:78192845-78192867 CCCAGGCATCTGCCTCTGAAAGG - Intronic
1153656553 18:7287971-7287993 GCCAGGATTTTGCTTCTGAAAGG - Intergenic
1153689055 18:7573440-7573462 CCCAGGAAGCAGCCTTTGAAAGG - Intronic
1153710128 18:7790348-7790370 GGCAGGATGCTGCCTGTGAAAGG - Intronic
1155109173 18:22697052-22697074 CCCAGATTGCTGGTTCTGGAAGG - Intergenic
1159036873 18:63285964-63285986 CCCAGGCTGCTGTTGCAGAAAGG - Intronic
1159420092 18:68206537-68206559 CCCACGAAGCTGGTTCTAAATGG + Intergenic
1161958212 19:7507881-7507903 CCCAGGCTTCACCTTCTGAAGGG + Intronic
1161959993 19:7517895-7517917 CTCAGAATGCTGCTGCTGGAGGG + Intronic
1162832651 19:13296491-13296513 AAGAGGATGCTGGTTCTGAATGG + Intronic
1162833508 19:13301519-13301541 CCCAGGGTGCTGCTGCTCACTGG + Intronic
1162910320 19:13844408-13844430 CCCAGGATGCAGGATCTGACAGG + Intergenic
1163173448 19:15548782-15548804 CTCAGGATGCAGATTTTGAAAGG + Intronic
1163587636 19:18172820-18172842 CCCAGGCTGGGGCTTCTGGATGG - Exonic
1164143263 19:22493255-22493277 CCCAGCACGCTGCTTCTGACAGG + Intronic
1164469180 19:28514191-28514213 CCCAGGCTGGGGCTTCTGCAGGG + Intergenic
1164817605 19:31217097-31217119 CCCAGGAGGCAGCTTTTGAATGG + Intergenic
1164936984 19:32222865-32222887 GCCAGGATGCTGCTGCTGCCGGG - Intergenic
1165947364 19:39452234-39452256 TCCAGGATGCTGCTGGTGCATGG + Intronic
925215990 2:2096360-2096382 GCCAGACTGCTGCCTCTGAAAGG - Intronic
925296649 2:2781399-2781421 CCCAGGAAGCTTTTCCTGAATGG + Intergenic
926157570 2:10465627-10465649 CCGAGGATGCTGCTTCAGGTCGG - Intergenic
926289496 2:11517208-11517230 CACAGGATGGTGCTGCTGGAAGG - Intergenic
927579699 2:24230973-24230995 CACAGGATGCTCCTGCTGCAGGG + Intronic
928225395 2:29443900-29443922 CCTAGGATGTTTCTTCTGAAGGG + Intronic
928453467 2:31399054-31399076 ACCAGAAGGCAGCTTCTGAATGG + Intronic
930218541 2:48722168-48722190 CCCAGGATGCTGCTTCTGAATGG + Intronic
933505210 2:83168775-83168797 GCCACGATGGTGCTTCTTAAAGG - Intergenic
935101593 2:100001061-100001083 CCCTGGAGGCTGCAGCTGAAGGG + Intronic
935770883 2:106419060-106419082 CCCAGGAAAATGCTTCAGAAAGG - Intronic
935783844 2:106531520-106531542 GCCAGGATGCTGCCCCTGCAGGG + Intergenic
935909197 2:107876877-107876899 CCCAGGAAAATGCTTCAGAAAGG + Intronic
936130979 2:109842014-109842036 CCCAGGAAAATGCTTCAGAAAGG + Intronic
936213718 2:110529471-110529493 CCCAGGAAAATGCTTCAGAAAGG - Intronic
936422856 2:112384031-112384053 CCCAGGAAAATGCTTCAGAAAGG - Intronic
937070875 2:119062033-119062055 CTTAGGAGGCTGCTTCAGAAGGG - Intergenic
937204416 2:120226298-120226320 CCTAGGATGCTGGTGATGAAAGG - Intergenic
938789856 2:134666899-134666921 CCCAGGACGATGTCTCTGAAGGG - Intronic
938794598 2:134707012-134707034 ACCCGGAGGCTGCTTCTGAGAGG - Intronic
939057589 2:137382890-137382912 GCCAGGATGCTGCTGCTGCCTGG + Intronic
940104906 2:150088813-150088835 CCCATGCTCCTGCTTCTCAAAGG - Intergenic
943285493 2:185993526-185993548 TGCAGGATGCTGTCTCTGAATGG + Intergenic
945027005 2:205629367-205629389 CCCAGAATGCTACTTATCAAAGG - Intergenic
947444795 2:230155549-230155571 CCCAGGACACTGCATGTGAAGGG + Intergenic
947626543 2:231622686-231622708 CCCAGGATGCTGCTGCTCTGGGG + Intergenic
947663828 2:231890425-231890447 ACCAGGATGCTGAGTTTGAAGGG + Intergenic
948500443 2:238389173-238389195 CCCTGGATCCTGCTTCCGAGAGG + Intronic
1170060692 20:12255831-12255853 CCATGGATGTTGCTTCTTAAAGG + Intergenic
1170847040 20:19971107-19971129 CCCAGGAAGATGCCTCAGAAAGG - Intronic
1173498320 20:43534724-43534746 TCCAGGATCTTGCTTCTGACAGG + Intronic
1174115084 20:48221274-48221296 CACAGGCTGCTTCTCCTGAAAGG - Intergenic
1174499188 20:50971765-50971787 CTCAGGTTGCAGCTACTGAAGGG - Intergenic
1174687687 20:52471297-52471319 TCCAAGAAGCTGCTTCTGACTGG - Intergenic
1177513616 21:22121025-22121047 CCCAGCACGCTGCTTCTGTTAGG + Intergenic
1178411351 21:32366037-32366059 CCCAGAATGTGGCTTCTGATGGG + Intronic
1178495879 21:33085830-33085852 CCCAGGATGTTGGATCTCAAGGG + Intergenic
1180748042 22:18105157-18105179 TCCAGGATGCTGCTCCAGGATGG - Exonic
1181865588 22:25852063-25852085 CCCAGGGTGCTGGTGCTGAATGG - Intronic
1182213745 22:28698788-28698810 AACAGGATGCTGCACCTGAAGGG + Intronic
1183207678 22:36431009-36431031 CCCAGGAAGCATCTGCTGAATGG + Intergenic
1183627675 22:39014551-39014573 CCACGACTGCTGCTTCTGAATGG + Intronic
1183816935 22:40309941-40309963 CTTAGGATGCTGCTTGTGAAGGG - Intronic
1184648352 22:45908175-45908197 TCCAGGAAGCTCCTTCTGGAAGG + Intergenic
1184839738 22:47045801-47045823 CCCAGGAAGCTGCTGCTGTACGG + Intronic
1184888908 22:47367636-47367658 CCCAGGATGGTGGTTGTGAGTGG - Intergenic
1184975725 22:48060341-48060363 ACCAGGATGCTGCCTTTGCAGGG - Intergenic
949328059 3:2889219-2889241 CCCCTGATGCAGCTTCTGAGGGG + Intronic
949397835 3:3634077-3634099 CACAGGACGCTGGTTCTGATTGG + Intergenic
950481088 3:13244457-13244479 CCCAGGATCCTACGTTTGAATGG - Intergenic
952297937 3:32077494-32077516 CCCAGGAAGCTGCTTCTCCCTGG - Intronic
954434978 3:50491142-50491164 GCAAGGAGGCTGCTTCTGATGGG - Intronic
954689476 3:52388124-52388146 CTCAAGAGGCTGCTTCTCAAGGG - Intronic
959819106 3:110711221-110711243 TCCAGGATGCTGCTGATGTATGG - Intergenic
960596785 3:119414475-119414497 CAAAGAATGCTGCTTCTGAGGGG + Exonic
960726407 3:120674781-120674803 CCCAAGATCCTGCTTCTTATAGG - Intronic
960939438 3:122923738-122923760 GCCGCGATGCTGTTTCTGAAAGG + Exonic
961009114 3:123424296-123424318 CCCAGGACTCTGCTCATGAAAGG - Intronic
961829473 3:129616080-129616102 CCCAGGCTGATGGCTCTGAAGGG + Intergenic
962576452 3:136759427-136759449 ACCAGGTTACTGATTCTGAAAGG - Intergenic
963918618 3:150884446-150884468 CTCAGGATAATGCTTCTCAAAGG + Intronic
964341667 3:155714693-155714715 CCCGGGATGCTGCATTTGAAAGG + Intronic
968268115 3:197378221-197378243 CCCAGAATGCTGCAACTGCAAGG - Intergenic
971246194 4:24930337-24930359 CCCAAAATGGTGCTTCTGAATGG - Intronic
971267954 4:25111315-25111337 CACAAGCTTCTGCTTCTGAAAGG + Intergenic
972526615 4:39918969-39918991 CACAGAATACTACTTCTGAAAGG + Intronic
973109532 4:46379658-46379680 CCCAGGAATCTGAGTCTGAAAGG + Intronic
975874872 4:78824709-78824731 CTCAGGATGCTGCTTTTTAAAGG + Intronic
977358801 4:95979883-95979905 CCCAGGAAGCTGATTGTGAAAGG + Intergenic
977732646 4:100372626-100372648 ACCAGGGGGCTGCTGCTGAAAGG + Intergenic
978526911 4:109676961-109676983 CCCAGGATGCTGCTGCACACTGG - Intronic
979919543 4:126479867-126479889 CCCAGGACTCTGCTTATGATAGG + Intergenic
981773981 4:148343477-148343499 CCCAGGATGCCCATTCTGACTGG + Intronic
986575503 5:9208617-9208639 CCCAGGCTGCTCCTTCTGGCAGG - Intronic
990988135 5:61659950-61659972 CCCAGGATTCTGCTTGGGCAAGG + Intronic
993252837 5:85550313-85550335 CCCAGGAGGCAGCTGCTGACGGG + Intergenic
993548890 5:89249160-89249182 TGCAGGAAGCTGATTCTGAATGG + Intergenic
994301723 5:98155833-98155855 CCCAGGATTATGGTTCTGCATGG + Intergenic
995148992 5:108820287-108820309 CACAGGATGCTGGAACTGAAAGG + Intronic
995884786 5:116882194-116882216 CTCAGAATTCTGATTCTGAAAGG + Intergenic
997399178 5:133589311-133589333 CCCAGAACCTTGCTTCTGAAAGG + Intronic
997532820 5:134592772-134592794 CCTAGGATGCTACTTCAGTAAGG - Intergenic
998215788 5:140237878-140237900 CCCAGGATGCCACTTCAGGATGG + Intronic
998266525 5:140671374-140671396 CCAAGGATGCTGTGTCTGTACGG - Exonic
999649343 5:153750118-153750140 TCCAAGATGCTGCGTCTGAGTGG - Intronic
1003202876 6:3978526-3978548 CCCTGCATGCTGTTTATGAAAGG + Intergenic
1003228201 6:4225360-4225382 CCCACGATGCTGCAGCTGGACGG + Intergenic
1003556702 6:7146294-7146316 TCAAGAATGCTGCTGCTGAATGG - Intronic
1006716122 6:36121733-36121755 CGCTGGATGATGCTTGTGAAAGG - Intergenic
1007834053 6:44660790-44660812 TCTAGGCAGCTGCTTCTGAATGG - Intergenic
1011192371 6:84744007-84744029 CACTGCATGCTGTTTCTGAAGGG - Intronic
1012215027 6:96572359-96572381 GACAGGATGCTGCTTCAGCAGGG + Intronic
1012874164 6:104706294-104706316 CCCAGGATTTTGTTTCTGGAAGG - Intergenic
1015265106 6:131283845-131283867 CCCAGGATTCTGCACCTGGATGG - Intergenic
1018083420 6:160278335-160278357 CCCAGGATGGTGTTTGTGATAGG + Intergenic
1018435135 6:163752451-163752473 ACCAGGATGCTGGTTCTGTGGGG + Intergenic
1018887405 6:167951580-167951602 CGCAGGTGGCTGCTGCTGAACGG + Exonic
1021898772 7:25262768-25262790 CCCAGGATGCTGGATCTCCAAGG - Intergenic
1022477582 7:30721914-30721936 CCCAGGATGTTGAAGCTGAAGGG - Intronic
1024724149 7:52173113-52173135 TCCAGAATGCTGCTTCTTATAGG + Intergenic
1026824055 7:73570398-73570420 ACCAGGAGACTCCTTCTGAAAGG + Exonic
1029274515 7:99396298-99396320 CCCAGGAGGCAGCTGCTGACAGG - Exonic
1031848781 7:126838228-126838250 CCCAAGATGCTATTTCTAAAAGG - Intronic
1032557208 7:132848997-132849019 TCCAGTATTCTGTTTCTGAAAGG + Intronic
1035228115 7:157444638-157444660 CCCAGGAGGCTGTGTCTGGAGGG + Intergenic
1035384609 7:158462230-158462252 CCCAGGATGTCACTTCTCAAAGG + Intronic
1035399456 7:158555366-158555388 CCGTGGATGCTGCTTGTGAAGGG - Intronic
1035814946 8:2528842-2528864 CCCAGGAGGCTTGCTCTGAAAGG + Intergenic
1036111814 8:5911107-5911129 CCCAGCATGCAGCTTCAGGAGGG + Intergenic
1036709476 8:11068945-11068967 CCCAGGCTGCTCCTTTTCAATGG + Intronic
1037808659 8:22072889-22072911 CCCAGGATTTTGCTTTTGAAGGG + Intronic
1038912291 8:31979240-31979262 CCCAGGTTCTTGCTTGTGAATGG + Intronic
1040784467 8:51149211-51149233 TACAGGATGCTGTTTCTAAAGGG + Intergenic
1041232510 8:55768021-55768043 TCCAGGATACTGCTTCTGCAAGG - Intronic
1041965500 8:63670291-63670313 CCCAGGCTGCTGATGCCGAAGGG + Intergenic
1042786342 8:72550947-72550969 CTCAGAATGCTGCTGCTGGAGGG + Intronic
1043836136 8:85049026-85049048 CCCAGGATCCGGCAACTGAAGGG + Intergenic
1044751247 8:95417858-95417880 TCCAGGCTGCTGCTCCTGCATGG + Intergenic
1045239498 8:100386684-100386706 CCCAAGATGTTGCTTCTTGAGGG + Intronic
1045876392 8:106986057-106986079 GCCAGGATGCTTCTTCCAAAAGG + Intergenic
1047954285 8:129961420-129961442 CCTAGGATGCTGCTCCTAAAGGG - Intronic
1047999315 8:130364566-130364588 CCCAGGATGCTTTTTCTGTTGGG + Intronic
1048524643 8:135190920-135190942 CCCCAGATGCTGAGTCTGAATGG - Intergenic
1051167155 9:14275531-14275553 TCAAGGATACTGCTTGTGAATGG - Intronic
1051721908 9:20046069-20046091 ACCAGAATTCTTCTTCTGAAAGG - Intergenic
1052178963 9:25501852-25501874 CTCAGGTTGTTGCTTCAGAAGGG + Intergenic
1052255810 9:26455100-26455122 CCCATTATCCTCCTTCTGAAGGG + Intergenic
1052352197 9:27469399-27469421 GCCAGGATGCTGTCACTGAAGGG - Intronic
1052620141 9:30898258-30898280 CCCAGGAAGCTGCTTCTCTCTGG - Intergenic
1053567424 9:39267893-39267915 CCCAGCATGGTGCCTATGAAGGG + Intronic
1053833440 9:42108843-42108865 CCCAGCATGGTGCCTATGAACGG + Intronic
1054129719 9:61351105-61351127 CCCAGCATGGTGCCTATGAAGGG - Intergenic
1054597109 9:67078568-67078590 CCCAGCATGGTGCCTATGAACGG - Intergenic
1056113151 9:83415982-83416004 GCCCAGATGCTGGTTCTGAAGGG - Intronic
1057077797 9:92147990-92148012 CCCAGGAGGCTGCTTCTAAGAGG + Intergenic
1057487095 9:95494222-95494244 CCCAGGCTGCTCCCTCTGAATGG + Intronic
1057940990 9:99284137-99284159 CCAAGGATGTAGCTTCTGGAGGG - Intergenic
1060896656 9:127223286-127223308 CTGAGGATGCTGCTCCTGCAGGG - Intergenic
1061829409 9:133281325-133281347 CCCAGGAGGTTGCTTCTTTAAGG + Intergenic
1062396087 9:136353451-136353473 CCCAGGGTCCTGCTTCTGAGGGG + Intronic
1062476736 9:136731728-136731750 AGCAGGATGCTGCTTCAGAAGGG + Intergenic
1190070058 X:47272277-47272299 CCCATTCAGCTGCTTCTGAAAGG - Intergenic
1191992147 X:67050131-67050153 CTCAGCCTTCTGCTTCTGAAAGG + Intergenic
1192182446 X:68924673-68924695 CCCAGGCTGCAGCTTCTGCCTGG + Intergenic
1199990716 X:152986318-152986340 CCCAGGAGGCTGCTGCTTATTGG + Intergenic
1200033805 X:153315792-153315814 CCCAGGAGGCTGCTGCTTATTGG + Intergenic
1200972650 Y:9171924-9171946 CCCTGAATTCTGCTTCTGGAAGG - Intergenic
1202138368 Y:21692285-21692307 CCCTGAATCCTGCTTCTGGAAGG + Intergenic