ID: 930219774

View in Genome Browser
Species Human (GRCh38)
Location 2:48734750-48734772
Sequence CTGCTGTCCAGGGTCAAAAA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 152
Summary {0: 1, 1: 0, 2: 2, 3: 9, 4: 140}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
930219768_930219774 28 Left 930219768 2:48734699-48734721 CCAAGGAGAACTGAGGGCAAAAA 0: 1
1: 0
2: 3
3: 32
4: 273
Right 930219774 2:48734750-48734772 CTGCTGTCCAGGGTCAAAAAAGG 0: 1
1: 0
2: 2
3: 9
4: 140
930219771_930219774 3 Left 930219771 2:48734724-48734746 CCTAAGGCAAGGACAGTTCAGCA 0: 1
1: 0
2: 1
3: 6
4: 154
Right 930219774 2:48734750-48734772 CTGCTGTCCAGGGTCAAAAAAGG 0: 1
1: 0
2: 2
3: 9
4: 140

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
930219774 Original CRISPR CTGCTGTCCAGGGTCAAAAA AGG Intronic
900337815 1:2173402-2173424 CTGCTGTCCTTGGGCAAAACGGG + Intronic
903975937 1:27150318-27150340 CTCCTGACCAGGGACACAAAAGG - Intronic
904042670 1:27593441-27593463 CTGGTGTCCATGGGCAAAGATGG + Intronic
904493686 1:30875255-30875277 CTGATGTCCAGGCTGAAAAGAGG + Intronic
904610558 1:31723938-31723960 CTGCTGTCCAGGGTGCTGAAAGG - Intergenic
906293281 1:44633574-44633596 GTGCTTTCCAGGGACAACAAGGG + Intronic
907157778 1:52350311-52350333 CAGCTGCCCAGGCTCTAAAATGG - Intronic
907287865 1:53393499-53393521 CTGCTGGCCACAGACAAAAACGG + Intergenic
910599387 1:89014520-89014542 GTGCTGTTCTGGGTCACAAAAGG + Intronic
910603701 1:89059290-89059312 GTGCTGTTCTGGGTCACAAAAGG + Intronic
911659714 1:100487745-100487767 CTGAAGTCCAGGCTCAATAAAGG - Intronic
912034100 1:105289622-105289644 CTACTATCCAAGGTCAGAAATGG + Intergenic
914984117 1:152441796-152441818 CTGCTGACCAGAGGCTAAAACGG + Intergenic
917471502 1:175329937-175329959 CTGCTGGCCAGGGAGAAGAAGGG - Intronic
917610403 1:176683641-176683663 CTGGTGACCAAGGACAAAAATGG - Intronic
924414502 1:243845313-243845335 TTGCTGTAGAGTGTCAAAAAGGG + Intronic
1064810233 10:19188754-19188776 CTGTTGGCCAGTGTCAGAAATGG + Intronic
1064932036 10:20639125-20639147 TTGCTGTCCAAGGACAATAAGGG + Intergenic
1065838221 10:29678514-29678536 CTGCTGTGCAGGTTCCAAACAGG + Intronic
1066336880 10:34486784-34486806 CTGCTGCTCAGAGTCACAAAAGG - Intronic
1070161122 10:73867357-73867379 CTGCTCTCAAGGGCCAGAAAAGG + Intronic
1071211755 10:83349355-83349377 CTGATGTCTAGTGTCTAAAAAGG + Intergenic
1071261132 10:83920109-83920131 CTTATGTTCAGGGGCAAAAAAGG + Intergenic
1072598960 10:96905527-96905549 CTGATCTCCAGGGCCAAAATAGG + Intronic
1074920877 10:118009879-118009901 CTGATAACCAGGGTCAAAAAGGG - Intronic
1075472376 10:122701308-122701330 CTGATGTCCAGGCTCACAGATGG - Intergenic
1077119704 11:901192-901214 CTGCTCTGCAGGGTCAGGAAGGG - Intronic
1078261659 11:9715264-9715286 CTACTGTGCAGGGCCTAAAAGGG + Intronic
1079471636 11:20783758-20783780 CTGCTGTACAGTGGCCAAAATGG - Exonic
1081581853 11:44357726-44357748 CTGGTGGCCAAGGTAAAAAAGGG - Intergenic
1082061230 11:47861923-47861945 CTGCTGTGCTGGGACAAGAATGG - Intergenic
1083603530 11:63962934-63962956 CAGCTGTCCAGGGTGATAGAGGG + Intergenic
1088720166 11:112585154-112585176 TTGCTTTCCAGGGGCAGAAAGGG - Intergenic
1092237394 12:6818827-6818849 GCGCTGTCCAGGGACAAGAAAGG - Exonic
1094818985 12:34210485-34210507 CTGCTTTCCAGTTTCCAAAACGG - Intergenic
1099710894 12:86223377-86223399 CTGCTACCCAAGGACAAAAAAGG + Intronic
1101502411 12:105316488-105316510 CTGTTGTTCAGGATCATAAAAGG - Intronic
1103736825 12:123065876-123065898 CTGCTGTCCAGGATGACAGAGGG - Intronic
1103963364 12:124622969-124622991 CTGCTGTACCGGCTCAGAAACGG - Intergenic
1105505413 13:21005451-21005473 TTCAGGTCCAGGGTCAAAAAAGG + Intronic
1106147951 13:27068133-27068155 CTTCTTTCCAGGGTAAAAAATGG + Exonic
1111006014 13:82249999-82250021 CTGCTCTCCATGATCAAAATAGG + Intergenic
1118703055 14:68453508-68453530 TAGCTTTCCAGGGTGAAAAAGGG - Intronic
1119599234 14:75963633-75963655 CTGATGTCCAGGTGCAGAAAGGG + Intronic
1120767994 14:88348682-88348704 CAGCTTTGCAGGGTTAAAAATGG - Intergenic
1127805121 15:62512089-62512111 CTGCTGTCCTGGGTCACAGCTGG + Intronic
1129831935 15:78676326-78676348 CGGCTGAGCAGGGTCAGAAAAGG + Intronic
1130717049 15:86345052-86345074 CTGCTCCCCAGAGTCTAAAACGG - Intronic
1131290283 15:91101019-91101041 CTGCTGTCCAGGGTTCAGCAGGG + Intronic
1134681209 16:16127042-16127064 CTGCTGTTCAGGGCCTAAGAAGG - Intronic
1134845853 16:17439675-17439697 CTGCTTTCCATTGTTAAAAAGGG + Intronic
1137554020 16:49458962-49458984 CTGCTTTCTAGGGTAAATAAAGG + Intergenic
1137713683 16:50584816-50584838 CTGCTGTCCACACTCATAAAGGG - Intronic
1141407778 16:83808563-83808585 CAGCTGTCCAGAGGCAGAAATGG + Intronic
1144077444 17:11732113-11732135 CTACTATCCAGGGGCAACAATGG - Intronic
1146565900 17:33912557-33912579 CTGCTGTCAAGGGGAAAAGATGG - Intronic
1147020710 17:37530394-37530416 CTGATCTCCAGGTTCACAAATGG + Intronic
1147873374 17:43603417-43603439 CTGCTCTCAAGGGTCCCAAAAGG - Intergenic
1148469322 17:47883721-47883743 CTGCTTTCCTGGATCAAAATGGG - Intergenic
1149143969 17:53467633-53467655 CTGCTGTTCAGGGTGGAAACAGG + Intergenic
1149638306 17:58187121-58187143 TTCCTTTCCAGGGTGAAAAAGGG + Intergenic
1152651023 17:81493022-81493044 CTGCTGTCCTGGGTCAGAAAAGG - Intergenic
1152693828 17:81734089-81734111 CGGCTGTCCAGGGTGAAACAGGG + Intergenic
1153019569 18:614586-614608 CTGCTTTGCAGGGTGAGAAATGG - Intronic
1153485148 18:5590440-5590462 CTGCTGTCGAGGATGCAAAATGG + Intronic
1158541579 18:58360980-58361002 CTTCTGTCCAGGACCATAAATGG - Intronic
1159773521 18:72576584-72576606 CTGCTGTCAAGGGTATAAATTGG + Intronic
1160391976 18:78540724-78540746 CTACTGACCAGGTTCAAAACTGG + Intergenic
1161138223 19:2633230-2633252 CTGCTGTAGAGGGTCAGAGAGGG + Intronic
1162502031 19:11059646-11059668 CAGCTGTCCAGGGGCAACACAGG + Intronic
1164992430 19:32693922-32693944 CTGCTGGACAGGGGCAAAGAAGG + Intronic
1166321578 19:42022263-42022285 CTGATCCCCAGGGTCATAAAGGG + Exonic
927083573 2:19653532-19653554 CTGGTGTCCAGGCTGAAATATGG + Intergenic
928954936 2:36856208-36856230 CTGCTGTCAAAGGTGTAAAATGG + Intronic
929003011 2:37366722-37366744 CTGCAGTGCAGGTTCAACAACGG + Intronic
929871210 2:45760848-45760870 CTGGTGTCCAGAGGCATAAAGGG + Intronic
930219774 2:48734750-48734772 CTGCTGTCCAGGGTCAAAAAAGG + Intronic
941204960 2:162560497-162560519 CTGGCATCCAGGGTTAAAAAGGG + Intronic
941209557 2:162620474-162620496 TTGCTTTCAGGGGTCAAAAAAGG - Intronic
942123953 2:172804742-172804764 CAGCAATCCAGGGGCAAAAAAGG - Intronic
942791912 2:179770137-179770159 CTTGTGTCCAGGGTCAGAAAGGG - Intronic
947797030 2:232901203-232901225 CTGCAGTTCACGGTCAAACATGG + Intronic
1169664625 20:8019943-8019965 CTGCTGCCCAGGCTCCAATAAGG + Intergenic
1170157347 20:13280639-13280661 CTGGTGTCCAGGGAAAGAAAGGG + Intronic
1171458214 20:25283607-25283629 CAGCTCTCCAGGGGCAAAGAGGG - Intronic
1172169596 20:32920978-32921000 GGGGTGTCCAGGGTCAGAAAGGG - Intronic
1175272964 20:57747948-57747970 CTGCTCTCTTGGTTCAAAAAAGG + Intergenic
1178690113 21:34743458-34743480 CTGCTGTCCAGGGTCAGCCACGG + Intergenic
1181774298 22:25148387-25148409 CTGCTGTCCAGGGTGCTAAGTGG + Intronic
1184400020 22:44268361-44268383 GTGCTGACCAGGGGCAAGAAGGG - Intronic
950523703 3:13511064-13511086 CTGCTTTGCAGGGTAAATAAAGG - Intergenic
950639037 3:14336068-14336090 CAGCTGTCCAGGGTCAAGTTCGG + Intergenic
955186322 3:56718661-56718683 CTGCTGGACAGGGGCAAAGAAGG - Intergenic
955786253 3:62542572-62542594 CTGCTGCCCAGAGGCACAAATGG + Intronic
959790197 3:110351174-110351196 CTGCTATCAAGTGACAAAAATGG - Intergenic
961167906 3:124776266-124776288 CTGCTGCCAAGGCTCAAAAGTGG - Intronic
963564573 3:146912427-146912449 CTGCTCTCCAGGGTGAGGAATGG - Intergenic
964444281 3:156742328-156742350 CTACTATCCTGGGTCTAAAAAGG - Intergenic
965051575 3:163655958-163655980 CTTCAGTCCAGGGTTAAATATGG + Intergenic
966563758 3:181352659-181352681 ATGTTGCCCAGGGTCAAAAAAGG - Intergenic
966666048 3:182472102-182472124 CTGCTTTCCAGGGTAAACCAGGG + Intergenic
968790467 4:2657246-2657268 CTTCTGTCAAGGCTGAAAAAGGG - Intronic
970297201 4:14642563-14642585 CTGCTGGCAAGAGTTAAAAAGGG + Intergenic
970781570 4:19744106-19744128 CTGCTGTTCAGAGAGAAAAATGG - Intergenic
974154832 4:58057399-58057421 TTGCTGTCAAGGGCCAAAAGGGG + Intergenic
978368160 4:108004057-108004079 ATGCCTTCCAGGGTCAAGAAAGG + Intronic
983521457 4:168713402-168713424 CTGCTCTCCAGGGAGAGAAAGGG + Intronic
986821259 5:11469249-11469271 CTGATTTCCAGGGGGAAAAAAGG - Intronic
995379649 5:111517878-111517900 CTGGTGTCCAGGGGGAAACAGGG + Intergenic
997717571 5:136053389-136053411 CTGCTGTGCATGGGCAAAGAGGG + Intronic
999324063 5:150632122-150632144 CTGATGCCCAGGGAGAAAAAGGG - Intronic
1000482534 5:161797040-161797062 CTGTTTTCCAGGGCCAAACATGG - Intergenic
1002281041 5:178130439-178130461 CTGCTGTCCAGGGAAAATGATGG - Intergenic
1002281319 5:178131481-178131503 CTGCTGTCCAGGGAAAATGATGG + Intronic
1002390855 5:178910553-178910575 TTGCTGCCCAGGGTCAATGAGGG + Intronic
1004063259 6:12218744-12218766 ATGCTGTGTAGGGTCAAGAATGG - Intergenic
1004366547 6:15018039-15018061 TTTCTGTCCTGAGTCAAAAAAGG - Intergenic
1004392592 6:15222067-15222089 CTGCAGTGCAGGGTCAAGACAGG - Intergenic
1006644401 6:35506058-35506080 CGGCTGACCCGGGACAAAAAGGG - Exonic
1010294738 6:74182809-74182831 CTCCTGTCCAGTGTCCAAGAAGG - Intergenic
1012440976 6:99262061-99262083 CTGCTGGACAGGGGCAAAGAAGG + Intergenic
1016184596 6:141183253-141183275 CTGCTGGACAGGGGCAAAGAAGG - Intergenic
1016578922 6:145605675-145605697 CTGCTTTCCAGATACAAAAAAGG + Intronic
1019859965 7:3649062-3649084 CTGCTTGCCAGGGACAGAAAGGG + Intronic
1023721269 7:43097618-43097640 CTGCTCTTCAGGGAAAAAAAAGG + Intergenic
1023864676 7:44233108-44233130 CTGCTGTCCAGGGTGGGAGATGG + Intronic
1024757298 7:52549952-52549974 CTGCTGTCCAGGGTCAAAGCTGG - Intergenic
1028457556 7:91055057-91055079 CTGCAGCCCTGGGTCAAGAAGGG + Intronic
1028884010 7:95911436-95911458 CTTCAGTTAAGGGTCAAAAAAGG + Intronic
1029056065 7:97744019-97744041 CTGTTGCCCAGGCTCAAATATGG - Intergenic
1029435608 7:100562492-100562514 CTGCTCTCCAGGGTGAGTAAGGG - Intronic
1034313692 7:150111210-150111232 CTGCGGTCCAGGGAGGAAAAGGG - Intergenic
1034534117 7:151716370-151716392 CAGGTGCCCAGGGTCACAAAGGG - Intronic
1034793208 7:153989586-153989608 CTGCGGTCCAGGGAGGAAAAGGG + Intronic
1035853427 8:2945419-2945441 CTACTGTCCAGGGACATTAAGGG + Intronic
1036642468 8:10592939-10592961 CTGCTGTCCAGGGTGGAGAGGGG - Intergenic
1038716921 8:29999410-29999432 GTTCTCTCCAGGGTCACAAATGG - Intergenic
1040788179 8:51192130-51192152 CAGCTTTCCATGTTCAAAAAGGG + Intergenic
1040900663 8:52414259-52414281 CTGCTCTCCAGTGTTATAAAAGG + Intronic
1045190102 8:99873439-99873461 CTGCTGTCCAGGGCTGAAAGAGG + Intronic
1048136935 8:131755582-131755604 CAGATGTCCTGGTTCAAAAATGG + Intergenic
1049293383 8:141816207-141816229 CTGTTCTCCAGAGTCAACAAGGG - Intergenic
1049319429 8:141988108-141988130 CAGCTGTGCAGGGTCACAAAAGG - Intergenic
1049880463 8:145058623-145058645 CTGCTGAGCAGGATCAACAATGG - Intergenic
1050353225 9:4760071-4760093 CTGCTGTCCAGCATAAAACAGGG + Intergenic
1050849040 9:10260833-10260855 CTGCTGGCAAGGGACAAACAAGG - Intronic
1055480619 9:76705818-76705840 CTCCCGTCCAGGCTCATAAATGG + Exonic
1055920806 9:81459043-81459065 CTGGAGTCCAGGGTCACAAAGGG - Intergenic
1057115789 9:92520244-92520266 CTGCTGTCCAGGCTGGAATACGG - Intronic
1060956643 9:127646092-127646114 CGGCTGTCCAGGTGCAAGAAAGG - Intronic
1185734910 X:2489188-2489210 CTGCTGGACAAGGTCAAAGACGG - Exonic
1198194173 X:134343372-134343394 CTGCTGTTCAGGGTAAATAAAGG - Intergenic