ID: 930222103

View in Genome Browser
Species Human (GRCh38)
Location 2:48755527-48755549
Sequence CCGTGGGGCCGGGGCAGCGC AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 559
Summary {0: 1, 1: 1, 2: 3, 3: 47, 4: 507}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
930222093_930222103 19 Left 930222093 2:48755485-48755507 CCGCGACGGGAGCGCTGTGTACT 0: 1
1: 0
2: 0
3: 0
4: 15
Right 930222103 2:48755527-48755549 CCGTGGGGCCGGGGCAGCGCAGG 0: 1
1: 1
2: 3
3: 47
4: 507

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
930222103 Original CRISPR CCGTGGGGCCGGGGCAGCGC AGG Exonic