ID: 930222103

View in Genome Browser
Species Human (GRCh38)
Location 2:48755527-48755549
Sequence CCGTGGGGCCGGGGCAGCGC AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 559
Summary {0: 1, 1: 1, 2: 3, 3: 47, 4: 507}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
930222093_930222103 19 Left 930222093 2:48755485-48755507 CCGCGACGGGAGCGCTGTGTACT 0: 1
1: 0
2: 0
3: 0
4: 15
Right 930222103 2:48755527-48755549 CCGTGGGGCCGGGGCAGCGCAGG 0: 1
1: 1
2: 3
3: 47
4: 507

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
930222103 Original CRISPR CCGTGGGGCCGGGGCAGCGC AGG Exonic
900082660 1:870044-870066 CCGTGGAGCCGCGGCCCCGCTGG - Intergenic
900119067 1:1040962-1040984 CAGTGGGGCGGGGGCAGGGGCGG + Intronic
900121124 1:1049121-1049143 AGGGGGGGCCGGGGCAGCTCAGG + Intronic
900139787 1:1134862-1134884 CCCTGGGGGCTGGGCAGCGATGG + Intergenic
900291046 1:1923725-1923747 GCGTGGGGCCAGGGCCGGGCCGG + Intronic
900329582 1:2127401-2127423 CCGTGGGGCAGGGGCGGCGGTGG - Intronic
900361368 1:2290603-2290625 CCGTGTGTCTGGGCCAGCGCTGG + Intronic
900427451 1:2587030-2587052 CCGCGGGGCCTGGGCGGGGCTGG + Intronic
900898993 1:5504139-5504161 CCCTGGGGCTGGGGCAGGTCTGG + Intergenic
901005757 1:6170834-6170856 CGGTGGGGCAGTGGCAGGGCTGG + Intronic
901109767 1:6785423-6785445 CCGCGGGGCGGGGCCAGGGCGGG + Exonic
901181971 1:7348044-7348066 CCGTGGGACAGAGGCAGCTCTGG + Intronic
901517149 1:9755663-9755685 CCCAGGAGCTGGGGCAGCGCTGG - Intronic
901882436 1:12202131-12202153 CAGTGGGGCCGGGGAGGCCCGGG + Exonic
902042701 1:13504330-13504352 CCATGGGTCTGGGGCAGGGCTGG - Intronic
902072183 1:13749507-13749529 GCGTGGCGCCGGGGCCGGGCGGG - Intronic
902226245 1:14998148-14998170 GCGGGGGGGAGGGGCAGCGCGGG + Intronic
902584988 1:17433414-17433436 CCGGGGCGGCGGGGCAGGGCGGG + Intronic
903069074 1:20717776-20717798 CCAAGGGGCGGGGCCAGCGCCGG + Exonic
903153251 1:21428111-21428133 CCGGGGAGCCGGGGCCGGGCGGG + Intergenic
903676213 1:25066177-25066199 CCATGGGGCCAGCGCAGGGCAGG - Intergenic
903968032 1:27101927-27101949 CCGAGGGGCACGGGCAGGGCAGG + Intronic
904237477 1:29124279-29124301 CTGCGGGACCGGGGCAGAGCAGG - Intergenic
904517306 1:31066096-31066118 CTCTGGGGCCAGGGCAGTGCGGG - Intergenic
904618184 1:31761014-31761036 CCCTGGGGGCGGTGCCGCGCGGG + Intronic
904753416 1:32754924-32754946 CCGTGGGGACGGGGGAGGGGGGG - Intronic
904942540 1:34175302-34175324 TCCTGGGGCCTGGGCAGTGCAGG + Intronic
905212763 1:36385793-36385815 CCGGGGGGCCGGGGCCGGGCTGG + Exonic
905626283 1:39492154-39492176 GCGCGGGGCCGGGGCCGCCCGGG - Exonic
905643823 1:39610375-39610397 TCCTGGGGCCGAGGCAGCGGGGG + Intergenic
905670613 1:39788301-39788323 GCGCGGGGCCGGGGCCGCCCAGG + Exonic
906720016 1:47997477-47997499 GCGAGGGGCCGGGGCCGCGCCGG + Intergenic
907277668 1:53326278-53326300 GGGCGGGGCCGGGGCAGGGCAGG + Intronic
908132057 1:61083362-61083384 GCGGGGGGCTGCGGCAGCGCAGG - Intronic
912433720 1:109643793-109643815 CTGCGGGGCTGGGCCAGCGCGGG + Intergenic
912502277 1:110130348-110130370 CCCTGGGGGCGGGGGACCGCTGG + Intergenic
912881696 1:113422846-113422868 CGGTGGGGCCGGATCAGCCCAGG - Intronic
913194530 1:116444670-116444692 CAGTGGGGCTGGGGCTGGGCTGG - Intergenic
913485291 1:119327846-119327868 CCCTGGGGACGGTGCAGCGGAGG + Intergenic
913979633 1:143497649-143497671 CCCTGGCGCCGGGGCGGCGGGGG - Intergenic
915393252 1:155562838-155562860 CCGTGGGGGCGGGGAAGGGGGGG - Intergenic
915579062 1:156802558-156802580 TGGTGGGGCCGGGGCAAAGCTGG + Intergenic
915810925 1:158909830-158909852 CTGTGGGCCTGGGGCAGTGCTGG + Intergenic
917962346 1:180154981-180155003 CCGCGGGGCCGCGTTAGCGCCGG - Exonic
919465947 1:197921681-197921703 CAGGGAGGCCGGGGCTGCGCCGG - Intronic
919755501 1:201063723-201063745 CTGTGTGGCAGGGGCAGCGGGGG - Intronic
919828674 1:201522774-201522796 CTGTGGGGGTGGGGCAGGGCAGG + Intergenic
920286109 1:204881073-204881095 CCCTGGGGCAGGGGCAGAGGTGG + Intronic
920491037 1:206415500-206415522 CCGAGGGGCCAGGGCAGGGTGGG + Intronic
920850716 1:209626411-209626433 CAGTGAGGCAGGGGCAGAGCTGG + Intronic
921390433 1:214608774-214608796 CGATGCGGCCGGGGCAGGGCGGG + Intronic
922815595 1:228446670-228446692 CCGTGGGGGCGGGGCGGGGTGGG + Intergenic
922851320 1:228735848-228735870 CCGGGGGGCCGGGGGCGTGCGGG + Exonic
923540751 1:234886389-234886411 CCGTGGGGCCAGGGACACGCAGG - Intergenic
924037554 1:239953012-239953034 CCGTGGGGAGGGGACAGGGCTGG - Intergenic
1063593331 10:7411836-7411858 CCGTGAGCCCCGGGCAGGGCTGG + Intergenic
1064060026 10:12129595-12129617 CCCTGGGGGCGGGGCTGGGCCGG + Intergenic
1064220918 10:13439844-13439866 CCGAGGGGCTGGGACGGCGCGGG - Intronic
1065101473 10:22336059-22336081 CGGTGGGGACCGGGCAGAGCAGG - Intergenic
1065925979 10:30434130-30434152 CCGTGAGTCAGGGGCAGAGCAGG + Exonic
1066460341 10:35607837-35607859 CCCGGGGGTCGGGGCAGCGGCGG - Exonic
1067258615 10:44666706-44666728 CAGTGGGGCCAGGCCAGCCCAGG - Intergenic
1067478080 10:46579195-46579217 CAGAGGGGCCGGGGCTGGGCTGG - Intronic
1067616660 10:47762592-47762614 CAGAGGGGCCGGGGCTGGGCTGG + Intergenic
1067669509 10:48306580-48306602 CCGGCGGGGCGGGGCAGCCCCGG - Intergenic
1067682748 10:48450873-48450895 CCGGGGAGCCGGTGCAGCCCTGG - Exonic
1067780300 10:49197557-49197579 CCGTGGAGCCGGGACAGTGCTGG + Intergenic
1067847664 10:49736559-49736581 CAGAGGGGCTGGGGCAGCTCAGG + Intronic
1069769522 10:70888476-70888498 CAGCGGGGCCGGGGCAGCCGCGG - Intronic
1070786126 10:79163132-79163154 TCGTGGTGCTGGGGCAGCCCGGG + Intronic
1070787957 10:79173092-79173114 CCCTGGGGCCTGGGCTGCTCAGG + Intronic
1071784111 10:88880211-88880233 CCCAGGGGCCGGGGCAGGGGAGG + Exonic
1072784071 10:98268403-98268425 CCGGGGGGCGGGGGGAGCGGGGG + Intergenic
1073063712 10:100746366-100746388 GCGAGGGGCCGGGGCCACGCTGG - Intronic
1073067742 10:100773731-100773753 CTGGGGGGCCGGGGCAGCCTGGG - Intronic
1073099114 10:100997856-100997878 CCCTGGAGCCGGGGCGGAGCAGG + Intronic
1073443665 10:103568214-103568236 GGGTGGGGCTGGGGCAGCACAGG - Intronic
1075736311 10:124666651-124666673 GCGTGTGGCCGGGGCAGGGCTGG - Intronic
1076035644 10:127196608-127196630 AGGTGGGGCGGGGGCGGCGCGGG + Intronic
1076320824 10:129580215-129580237 CCGGGGGGGCGGGACTGCGCAGG + Intronic
1076562158 10:131374034-131374056 CAGTGGGGCCTGGGCAGGGAGGG - Intergenic
1076750095 10:132538078-132538100 CCATGGTGCCCGGGCGGCGCGGG - Exonic
1076868715 10:133182275-133182297 GCCTGGGGCCAGGGCAGCCCAGG + Intronic
1077008517 11:369980-370002 GCGGGGGGCGGGGGCGGCGCGGG + Intronic
1077052929 11:575901-575923 GCGTGGGGGCGGGGCTGCGAGGG + Intergenic
1077112989 11:870082-870104 CCGTGGGACCGGGGGAGGGGTGG - Intronic
1077147746 11:1053501-1053523 ACCTGGGGCCGGGCCAGGGCAGG + Intergenic
1077308993 11:1880273-1880295 CCCTGGGGCCTGGGCAGAGGGGG + Intronic
1077317766 11:1926995-1927017 CCTTGAGGCCGAGGCAGAGCAGG + Intronic
1077886255 11:6390299-6390321 CCGTGCGCCCGGGGCAGGGCGGG + Intergenic
1078317309 11:10304563-10304585 CGGAGGGGCCGGGGCAGGGACGG - Intergenic
1078547546 11:12256977-12256999 CCCAGGGGCCAGGGCAGCACTGG + Intronic
1078987076 11:16607134-16607156 CCGAGGGGCTGGGGCAGGACAGG - Intronic
1079427628 11:20358568-20358590 GCATGGGGCAGGGGCAGGGCAGG - Intergenic
1079674128 11:23203259-23203281 CAGTGGGGCCAGGCCAGCCCAGG + Intergenic
1081763836 11:45595451-45595473 CCCTGGGTCTGGGGCAGGGCAGG - Intergenic
1083629531 11:64088447-64088469 CTGTGGGCCTGGGGCAGGGCAGG + Intronic
1083753792 11:64778325-64778347 CCGGGGAGCGGGGGCAGCCCGGG + Exonic
1083856777 11:65396871-65396893 CCGTGGGGCCAGGGCCGGGCCGG + Exonic
1084129140 11:67119621-67119643 CCGGGGGGCCGGGGCGGCGCGGG + Intronic
1084165630 11:67373536-67373558 CCATGGGGCTGGGGCCGGGCCGG + Exonic
1084557473 11:69883597-69883619 CCGTGGTGGCGGGACAGCCCTGG - Intergenic
1084967579 11:72752475-72752497 AGGTGGGGCTGGGGCAGGGCAGG + Intronic
1085312771 11:75525973-75525995 CCGTCCGGGCGGGGCCGCGCAGG - Intergenic
1085407122 11:76269960-76269982 CCCTGGGGTCTGGGCAGCCCTGG - Intergenic
1085741532 11:79081750-79081772 TGGTGGGGCAGGGGCAGGGCGGG + Intronic
1088462136 11:110093168-110093190 CCCTGGAGCTGGGGCAGCCCCGG - Intergenic
1088495692 11:110429847-110429869 CCATGGGGCGGGGCCAGCGCAGG - Intergenic
1089457721 11:118635065-118635087 CCGCGGGGCCGGGGGAGGGGGGG - Intronic
1089729596 11:120511927-120511949 CGGGGGCGCGGGGGCAGCGCAGG - Intronic
1089981464 11:122776424-122776446 CCCTGGGGCCAGGGCAGAGGAGG - Intronic
1090768258 11:129895608-129895630 CGGAAGGGGCGGGGCAGCGCGGG + Intergenic
1090829650 11:130412055-130412077 CCGTGGGGCCTGTGCATTGCTGG - Intronic
1091273279 11:134332484-134332506 CAGTGGGGACGGGGCCGCGATGG - Intronic
1091405035 12:203754-203776 GAGAGGGGCCGGGGCGGCGCTGG + Intronic
1091690015 12:2589548-2589570 GCGAGAGGCCGGGGCAGGGCAGG + Intronic
1091730591 12:2877323-2877345 CCGTGGGGCCGGGGAGGGGCCGG + Intronic
1091789688 12:3264599-3264621 GGCTGGGGCCGGGGCAGTGCGGG + Intronic
1092159950 12:6310695-6310717 CCGCGGGAGCCGGGCAGCGCGGG - Intronic
1092240131 12:6831136-6831158 CCTTGGGGCAGAGGCAGTGCTGG - Intronic
1092280910 12:7097035-7097057 CCGTGGGGGCGGGGCCCTGCTGG - Exonic
1096156751 12:49345432-49345454 CCGCGGGGCCGGGGCTTCGGCGG + Intergenic
1096178365 12:49537991-49538013 CCGGGGGACCGTCGCAGCGCGGG + Intergenic
1096241299 12:49961684-49961706 CCGGGGGGCGGGGGTCGCGCCGG + Intergenic
1096791393 12:54047350-54047372 CCGCGGGGCCGCTGCAGAGCCGG + Intronic
1097278627 12:57830483-57830505 CCTTGGGGCTGGGGCTGCTCTGG - Intronic
1099095813 12:78372870-78372892 CAGTGGGGCAGGGGCAAGGCAGG - Intergenic
1101371684 12:104137481-104137503 CCGTGGGGCCGGGGCCACCCAGG - Intronic
1101452287 12:104790402-104790424 CTGTGGGGCCTGGGCACCTCAGG - Intergenic
1102247181 12:111362898-111362920 CGGCGGGGCAGGGGCAGGGCTGG + Exonic
1103320957 12:120092661-120092683 CCGTGAGGCCTGGTCAGAGCAGG + Intronic
1103360680 12:120351622-120351644 CCCTGGGCACGGGGCAGGGCTGG + Intronic
1103659240 12:122500562-122500584 GCGTGGGGCCGGGGCAGCGCCGG - Exonic
1103779398 12:123389108-123389130 CCGGGGCGCCGCGGCGGCGCTGG + Intronic
1104004081 12:124880028-124880050 CAGTGGGCCCTGGGCAGAGCGGG - Intronic
1104845550 12:131845067-131845089 AGGCGGGGCCTGGGCAGCGCGGG - Intronic
1104866964 12:131961475-131961497 CCCAGGGGCCGGGGCAGCGGCGG - Exonic
1104885513 12:132104843-132104865 CCCAGGGGCCGGGGCAGCGGCGG - Exonic
1104902668 12:132197747-132197769 CCGTGGGGTTGGGGCGGGGCAGG - Intronic
1105512240 13:21060981-21061003 CGGCGGGGCAGGGGCGGCGCGGG - Intronic
1106614102 13:31310592-31310614 CGGTGGGGCTGGGCCAGCCCAGG + Intronic
1107916512 13:45157470-45157492 CCATGGAGTCGGGGCAGGGCTGG + Intronic
1108519532 13:51233972-51233994 CTGTAGGGCAGGGGCAGCCCAGG - Intronic
1112507710 13:99985146-99985168 CCGAGGCGCCGGTGCAGCACTGG + Intronic
1113599712 13:111559829-111559851 CCGTGGTGATGGGGCAGTGCAGG - Intergenic
1114452672 14:22837288-22837310 ACGAGGAGCCGGGACAGCGCGGG - Intronic
1115502258 14:34060320-34060342 CCCTCGGCCCGGGGCTGCGCTGG - Intronic
1115650981 14:35403114-35403136 CCGAGGGGGTGGGGCAGGGCAGG + Intronic
1115851791 14:37595160-37595182 GCGGCGGGCGGGGGCAGCGCCGG + Intronic
1116368899 14:44104952-44104974 CTGTGGGGCAGGGGCAGTGAAGG - Intergenic
1116928696 14:50668383-50668405 CGGTGGGGGAGGGGCAGCGGCGG - Intergenic
1117675567 14:58152006-58152028 ACGTGGCGCCGGGGCAGGGACGG - Intronic
1117803113 14:59464989-59465011 TGGCGGGTCCGGGGCAGCGCGGG - Exonic
1121121471 14:91378365-91378387 GCTTGGGGCCCGGGGAGCGCTGG + Intronic
1121342942 14:93115878-93115900 CGGGGCGGCCGGGCCAGCGCGGG - Intronic
1122081805 14:99272039-99272061 CCGCGGCGCCAGGGGAGCGCTGG - Intergenic
1122308353 14:100779533-100779555 CCGTGGTGACGGGGCTGGGCTGG - Intergenic
1122418188 14:101560387-101560409 CCCAGCGGCCGGGGCTGCGCTGG + Intergenic
1122484095 14:102066395-102066417 CTGGGTGGCCGGGGCAGCGTGGG - Intergenic
1122970880 14:105151748-105151770 CCGCGGGGAGGGGGCAGAGCTGG + Intronic
1123064244 14:105608336-105608358 CGGTGGGGCCTGGACAGCCCTGG - Intergenic
1123073548 14:105653975-105653997 CGGTGGGGCCTGGACAGCCCTGG - Intergenic
1123093479 14:105752745-105752767 CGGTGGGGCCTGGACAGCCCTGG - Intergenic
1123684466 15:22787066-22787088 CCGTGGCGTCGGCGAAGCGCCGG - Intronic
1124453628 15:29821807-29821829 CCCTCGGGCGGGGGCGGCGCGGG - Intronic
1124614458 15:31231429-31231451 CCATGGGGCAGGGGCAGTGGAGG + Intergenic
1125328881 15:38564104-38564126 CCGTGGGGCAGGGGCAACCGAGG + Intronic
1125535894 15:40441119-40441141 CCTGGGGGCCGGGGCCGGGCGGG - Intronic
1125677861 15:41512081-41512103 CAGTGGGGATGGGGCGGCGCCGG - Intronic
1126113221 15:45187551-45187573 CCGTGGCGCGGGGGCGGCGTGGG + Intronic
1128715340 15:69903706-69903728 CCATGTGGCCAGGCCAGCGCTGG - Intergenic
1131144468 15:90002148-90002170 CCGTAGGGGCGGGGCGGCGAGGG - Intronic
1131158738 15:90090811-90090833 CAGTGGGGCCTGGCCAGAGCTGG + Intronic
1131517548 15:93089148-93089170 CCGCTGGGCCGGGGAAGCACTGG - Intronic
1131799493 15:96054295-96054317 GGGTGGGGCCGGGGGAGGGCAGG - Intergenic
1132481845 16:170274-170296 CTGTGGGGCAGGGGCTGGGCTGG - Intergenic
1132537815 16:492079-492101 CCCTGGGGCAGGGACAGGGCAGG - Intronic
1132556878 16:576420-576442 CGCTGGGGCCTGGGCAGGGCAGG + Intronic
1132726867 16:1342671-1342693 CCTTGGGGCGGGGGCAGAGCTGG + Intronic
1132760519 16:1506636-1506658 ACGTGGGGCCAGTGCAGCGCCGG - Intronic
1132947131 16:2537951-2537973 GCGCGGGGGCGGGGCGGCGCCGG + Exonic
1132968549 16:2673434-2673456 GCGGGGGGCGGGGGCATCGCGGG - Intergenic
1133137245 16:3720616-3720638 CAGTGGGGCCGGGACAGAGCTGG + Intergenic
1135991783 16:27222968-27222990 AGGAGGGGCCGGGGCAGCTCCGG - Intergenic
1136412787 16:30086589-30086611 CAGAGGTGCCGGGGCAGCGGTGG + Exonic
1136519452 16:30786700-30786722 CCCGGGGGCCGGGGCAGGGGCGG - Intronic
1136588381 16:31202248-31202270 CCGTGGGGCCGGGGTCCCGTTGG + Intronic
1136634122 16:31508390-31508412 CCGTGCGGCAGGGGCGGGGCTGG - Exonic
1137263090 16:46846895-46846917 CCGTGGGGCGGGGGCGGGGGGGG - Intergenic
1137665381 16:50246329-50246351 CCGCGAGGCCGGGGAAGGGCGGG - Intronic
1138514570 16:57528999-57529021 GCGGGGGGCAGGGGCAGTGCGGG + Exonic
1139352889 16:66348327-66348349 CCGTGGGCCTGAGGCAGGGCTGG + Intergenic
1141169009 16:81679639-81679661 CCGTGGACCCGGGGCTGCTCTGG + Intronic
1141900732 16:86988665-86988687 CTGTGGGGTGGGGTCAGCGCTGG + Intergenic
1141959000 16:87392248-87392270 CCGAGGGGCGGGGCCAGAGCCGG - Exonic
1142136947 16:88455858-88455880 GCGCGGGGCCGGGGCAGCTCGGG + Intronic
1142156234 16:88533930-88533952 GCGGGCGGCCGGGGCAGCGAGGG + Exonic
1142186451 16:88697150-88697172 AAGTGGGGCCGGGGCAGGGTCGG + Exonic
1142517358 17:441392-441414 CTGTGGCTCCGGGGCACCGCGGG + Exonic
1142701117 17:1661563-1661585 CCCTGGGGCAGGGGCAGTGGTGG - Intronic
1143658716 17:8312122-8312144 CCCTGGGGACTGGGCAGCCCTGG - Exonic
1145190703 17:20841091-20841113 CGATGCGGCCGGGGCAGGGCGGG - Intronic
1145761286 17:27426577-27426599 CAGTGGGGCCTGGGGAGCACTGG + Intergenic
1145798243 17:27668126-27668148 CAGTGGGGCCTGGGGAGCACTGG - Intergenic
1145912859 17:28552515-28552537 CGGTGGGGCCGGGACGGCGACGG - Exonic
1146008434 17:29176886-29176908 CCGCGGGGCTGCGGCTGCGCCGG - Intronic
1146161332 17:30560734-30560756 CAGTGGGGCCTGGGGAGCACTGG + Intronic
1146401604 17:32504283-32504305 CCATGGGGGAGGGGCAGCCCAGG - Intronic
1147044739 17:37744274-37744296 CCGCGGGGCTGGGGCTGGGCCGG - Intronic
1147359598 17:39922581-39922603 CCGTGGAGCTGGGGCAGCTTGGG + Exonic
1147419361 17:40314498-40314520 CAGTGGGGGCAGGGCAGCACAGG + Intronic
1147536754 17:41326746-41326768 CAGTGGGGCCTGGGAAGCTCTGG + Intergenic
1149296414 17:55265707-55265729 GCGCGGGGCCGGGGCGCCGCGGG - Intronic
1150398212 17:64837196-64837218 CCGCGGGCCGGGGGCAGGGCCGG - Intergenic
1151214679 17:72569425-72569447 CCGTGGGGCCTGAGCCGCCCGGG + Intergenic
1151598724 17:75093605-75093627 CAGTGAGGCCGTGGCAGCGTCGG + Exonic
1151854360 17:76710695-76710717 CCGCGGGGCTGGGGGAGCTCGGG - Exonic
1152049201 17:77959129-77959151 CCGTGGCGCCGGCGCTGAGCGGG + Intergenic
1152135481 17:78500852-78500874 CCGTGGAGCAGAGGCAGCCCAGG + Intronic
1152237087 17:79144276-79144298 CCATGGGGCGGGGGTAGAGCGGG - Intronic
1152275918 17:79357064-79357086 CCGTGGGGCTAGGACAGAGCAGG - Intronic
1152439279 17:80295476-80295498 CTGTGGTGCTGGGGCAGCTCTGG + Intronic
1152542137 17:80981753-80981775 CGGAGGGGCTGCGGCAGCGCCGG - Intergenic
1152544157 17:80992313-80992335 CCGTGGGGTCCGCGCGGCGCTGG + Intronic
1152544660 17:80994693-80994715 GAGTGGGGCCCGGGCAGCGTGGG + Intronic
1152570381 17:81119006-81119028 CCGTGGGGCCGGGGCACCGTGGG + Intronic
1152575828 17:81140642-81140664 CCGTGGGGCCGGGGGACCGTGGG + Intronic
1152575860 17:81140730-81140752 CCGTGGGGCCGGGAGACCGTGGG + Intronic
1152575889 17:81140816-81140838 CCGTGGGGCCGGGAGACCGTGGG + Intronic
1152575922 17:81140909-81140931 CCGTGGGGCCGTGGGACCGTGGG + Intronic
1152617859 17:81346093-81346115 TCGTGGGGGCGGGGCGGCGGGGG - Intergenic
1152679013 17:81656175-81656197 GGGTCGGGCCAGGGCAGCGCAGG - Intronic
1152690550 17:81715950-81715972 CCGAGGGGCATGGGCAGCCCTGG - Intronic
1152695363 17:81741293-81741315 CTGCGGGTCCTGGGCAGCGCCGG - Intergenic
1152697721 17:81804992-81805014 CCGTGGGGGCGGGGCAGGCGTGG - Intronic
1152751905 17:82066089-82066111 ACTTGGGGGCTGGGCAGCGCAGG - Intergenic
1152779271 17:82219211-82219233 CCTGGAGGCCGGGGCAGCGATGG + Intergenic
1152781993 17:82230757-82230779 CCCTGGGGCAGGGGCGGGGCGGG + Intronic
1152834464 17:82520186-82520208 GCGTCGGGCCTGGGCTGCGCGGG - Exonic
1152878130 17:82800024-82800046 CAGTGGGGCGGGGACAGAGCAGG - Intronic
1153457333 18:5295596-5295618 GCGTGGGGCCGGGGCGCCCCGGG - Intronic
1154414622 18:14170498-14170520 GGGTGGGGCCAGGGCAGGGCAGG + Intergenic
1155231470 18:23779027-23779049 CCCTGGGGCAGGGGCAGCCCTGG + Intronic
1156171748 18:34494000-34494022 CCGGGGGCGCGGGGCCGCGCAGG + Intronic
1156454072 18:37283040-37283062 CCTTGGGGGCGGGGAAGAGCAGG - Intronic
1156467320 18:37356024-37356046 CCCTGGGGCCAGGCCAGGGCTGG - Intronic
1156514777 18:37670450-37670472 CCGTGAGCCTGGGGCAGCTCTGG + Intergenic
1157215049 18:45775609-45775631 CCGTGGCGGCGCGGCAGCTCGGG + Intergenic
1157309095 18:46538520-46538542 CCATGGGGGCGGGGCAGGACAGG - Intronic
1157449046 18:47772035-47772057 CCTTGGGCCTGGGGCAGAGCAGG - Intergenic
1157606741 18:48930585-48930607 CGGTGGGGGAGGGGCAGTGCTGG - Intronic
1160040009 18:75336957-75336979 CCCTGGGGCCGGGCCAGGCCTGG + Intergenic
1160175419 18:76590268-76590290 CCTAGGGCCCGGGGCAGCCCAGG + Intergenic
1160266281 18:77342773-77342795 CCCTGGGACCCTGGCAGCGCTGG - Intergenic
1160266305 18:77342867-77342889 CCCTGGGACCCTGGCAGCGCTGG - Intergenic
1160500751 18:79400254-79400276 CCGGGGGGCGGGGGCGGGGCGGG + Intronic
1160792554 19:929387-929409 CGGGGGAGCCGGGGCAGTGCAGG - Exonic
1160847763 19:1173947-1173969 CGGTGGTCGCGGGGCAGCGCGGG + Intronic
1160853667 19:1206374-1206396 CGGTGGGACCGGGGCGTCGCCGG + Intronic
1160859198 19:1230616-1230638 GCGTGGGGCTGGGGCAGAGCAGG - Exonic
1160870363 19:1275145-1275167 CCGTGAGGCCGGGGCAGGAGTGG + Intergenic
1160873069 19:1285805-1285827 CCGCGCGGCCGGGGCACGGCGGG + Intergenic
1160987989 19:1848385-1848407 CCCTGGGGCCCGGGCGGCTCCGG - Exonic
1160995804 19:1881500-1881522 CGATGCGGCCGGGGCAGGGCGGG + Exonic
1161014863 19:1978528-1978550 GGGTGGGGCGGGGGCTGCGCAGG + Intronic
1161221427 19:3119886-3119908 CCGTGGGGCAGGGGCCACGTAGG - Intronic
1161313345 19:3606908-3606930 CCGAGGGGCGTGGCCAGCGCAGG - Intergenic
1161608756 19:5229464-5229486 GCGGGGGGCCGGGGCGGGGCCGG - Intronic
1161719241 19:5894150-5894172 CCCTGGGGCTAGGGCAGAGCGGG - Intronic
1161958471 19:7509240-7509262 CCCTGGGGCCGGGGAAGGGTGGG + Intronic
1161959481 19:7516014-7516036 CCGGGGGGCGGGGGCAGCGATGG + Intronic
1162398344 19:10430749-10430771 CCGCGGGCCCGGGGCTGGGCAGG + Intronic
1162728137 19:12701952-12701974 CTGTGGGGGTGGGGCAGGGCAGG + Intronic
1163019509 19:14474904-14474926 CCATGGGGCAGGGGCAGAGATGG - Intronic
1163158148 19:15449961-15449983 CCGGGGGGGCGGGGCGGCGGGGG - Intergenic
1163617990 19:18340956-18340978 CAGGGGGGCCTGCGCAGCGCCGG - Intronic
1163832624 19:19554344-19554366 CGGTGAGGACGGGGCAGCTCAGG + Intergenic
1164803338 19:31096203-31096225 CTGTGTGACCGGGGCAGGGCTGG + Intergenic
1165058653 19:33194483-33194505 CCGGGGCGCGGGGGCAGCGGCGG + Intronic
1165069999 19:33249521-33249543 TCGTGGGTGCCGGGCAGCGCGGG - Intergenic
1165314957 19:35049199-35049221 CCCTGGGGGCAGGGCAGAGCTGG + Intronic
1165350558 19:35272873-35272895 TCGTGGGGCTGGGGCTGCTCTGG - Intronic
1165772594 19:38387797-38387819 CCCTGGGCCCGGGGCAGGGCAGG + Exonic
1166128231 19:40729414-40729436 AGGTGGGGCTGGGGCAGCCCTGG + Exonic
1166331525 19:42080579-42080601 CCGTGGGGCCTGGGCAGCAGCGG - Exonic
1166932351 19:46308778-46308800 GCGTGGGGCCGGGCCAGAGGAGG + Intronic
1167045320 19:47045955-47045977 CCGTGGGGCCTGGCAGGCGCTGG - Exonic
1167311177 19:48738884-48738906 CCGTGGGGCGGGGCCTGGGCGGG - Intronic
1167426481 19:49432353-49432375 GGGTGGAGCCGGGGCAGGGCAGG - Intronic
1167428783 19:49442818-49442840 CCATGGGGCCGGGGCAAGACTGG - Intergenic
1167483445 19:49746603-49746625 CTGGCGGGCCGGGGCAGCCCTGG + Exonic
1167738696 19:51311729-51311751 CCCCCGGGCCGGTGCAGCGCAGG + Intergenic
1167758656 19:51429221-51429243 CCCTGAGGCCTGGGCAGGGCAGG + Intergenic
1168072829 19:53962312-53962334 CCCTGGGGCGGAGGCGGCGCGGG + Intergenic
1168721848 19:58558649-58558671 CAGTGGGGGCGGGGCCGGGCGGG - Exonic
925419945 2:3703700-3703722 CCGAGAGGCTGCGGCAGCGCGGG - Exonic
925731382 2:6921676-6921698 CCGTGGGGTCAGGGCAGCATGGG + Intronic
925979275 2:9164087-9164109 CCCCGGGGCAGGGGCAGCACTGG + Intergenic
925985010 2:9207695-9207717 CCGCGGGTCCGGGGCATCCCGGG + Intronic
926131240 2:10304176-10304198 CCTGGGGGCTGGGGCAGGGCCGG - Intronic
926237315 2:11055326-11055348 CCTTGGGGCAGGGGCAGTCCCGG + Intergenic
927472618 2:23386620-23386642 TCGGGGGGCCGGGGGAGCCCAGG + Intronic
929061171 2:37925631-37925653 CCGTGGCGCAGGGTCAGCGAGGG - Intronic
929075048 2:38074134-38074156 CGGAGGGGTCGGGGCACCGCTGG + Intronic
930222103 2:48755527-48755549 CCGTGGGGCCGGGGCAGCGCAGG + Exonic
932152692 2:69387347-69387369 CTCGGGGGGCGGGGCAGCGCTGG - Intergenic
932480433 2:72035954-72035976 CCATGGTGCCGGGGCAGGCCGGG + Intergenic
932488067 2:72097963-72097985 CCCTGGGGCTGGGGCAGCTACGG - Intergenic
933658064 2:84905549-84905571 CCGAGGGGCGGGAGCAGCGCGGG - Intronic
934747386 2:96768455-96768477 CCGTGGGGCTGAGGGAGGGCAGG + Intronic
936104530 2:109613746-109613768 CCGCGGGGGCCGGGGAGCGCGGG + Intronic
936279154 2:111122666-111122688 GGCTGCGGCCGGGGCAGCGCGGG + Intronic
937291660 2:120785615-120785637 GCTTGGGGCAGGGGCAGGGCAGG - Intronic
937321881 2:120965887-120965909 CAGAGGGGCCAGGGCAGAGCAGG - Intronic
938034876 2:128027642-128027664 CAGAGCGGCCGGGGGAGCGCGGG - Intronic
938073130 2:128318732-128318754 CCGGGGAGCCGGGGCCGGGCGGG - Intergenic
941104868 2:161341075-161341097 CCGCGGGGCTGGGGGAGCTCGGG - Intronic
941476081 2:165953549-165953571 CCGAGCAGCCGGGGCACCGCAGG + Intronic
941911689 2:170770830-170770852 CCGGGGGGGCGGGGCGGGGCGGG - Intergenic
942965781 2:181891676-181891698 CCTTCCGGCCGGGGCCGCGCGGG - Intergenic
944428044 2:199604027-199604049 CCGTGGGGCCAGCCCAGTGCTGG + Intergenic
944653941 2:201859066-201859088 CTGGCGGGCCGGGGCTGCGCGGG + Intronic
947549814 2:231037970-231037992 GCGGCGGGCCGGGGCGGCGCTGG + Exonic
947734644 2:232448282-232448304 CCTTGGGGCCTGGGCAGAGCTGG + Intergenic
947749263 2:232524228-232524250 GGGTGGGGCCGGGCCAGGGCTGG - Intronic
947774577 2:232697508-232697530 CCATGCGGCCGGGCCAGCTCGGG - Intronic
948368952 2:237475361-237475383 CGGAAGGGCCGGGGCGGCGCGGG + Intergenic
948823135 2:240560472-240560494 CGTTGGGGCCGGGGCATGGCGGG - Exonic
1168773945 20:433141-433163 TCGTGGGCCCGGTGCAGGGCTGG + Intergenic
1169118625 20:3082831-3082853 CCCTGGGGCGGGCGCAGCTCGGG + Intronic
1169486982 20:6042051-6042073 CCGGGTGGCGGGGGCTGCGCTGG + Exonic
1170969104 20:21101915-21101937 CCTTGGGGCAGGGGCGGCGATGG + Intergenic
1171391917 20:24807112-24807134 CCGTGGGGCCTGGGCATCGTTGG - Intergenic
1172040388 20:32040611-32040633 GGGTGGGGCGGGGGCAGTGCTGG - Intergenic
1172096457 20:32462976-32462998 CAGTGGGGCCCGGGCAGGGATGG + Intronic
1172109560 20:32537048-32537070 CCGGGGGGGCGGGGCAGGGCAGG - Intronic
1172181854 20:33008416-33008438 CTGTGGGCCTGGGGCAGGGCTGG + Intronic
1172583204 20:36064647-36064669 CCCAGGGGCAGGGCCAGCGCGGG + Intergenic
1172966005 20:38835858-38835880 ACCGGGGGCCAGGGCAGCGCGGG - Exonic
1173470045 20:43316465-43316487 CCATGGGGCTGGCCCAGCGCAGG - Intergenic
1173852402 20:46227455-46227477 CCGTGGGGCGGGGCCAGGGGCGG - Intronic
1174035356 20:47665401-47665423 CCCTGGGGCCCGGGGAGTGCAGG - Intronic
1175368410 20:58470863-58470885 CCCTGGGGACGGGGCTGCGATGG - Intronic
1175429510 20:58891635-58891657 CGGGAGGGCCGGGGCAGCGCCGG - Intronic
1175758518 20:61545447-61545469 CCGTGCAGCCTGGGGAGCGCCGG - Intronic
1175856123 20:62122046-62122068 CCCAGGGTCCGGGGCGGCGCCGG + Intergenic
1175895247 20:62333140-62333162 CCGTGGGGCAGGGCCGGGGCAGG + Exonic
1175932705 20:62500286-62500308 CCGACGGGCAGGGGCAGCCCTGG - Intergenic
1175964914 20:62655582-62655604 CAGTGGGGCAGGGGCAGCGCAGG + Intronic
1176013554 20:62914614-62914636 GAAAGGGGCCGGGGCAGCGCAGG + Intronic
1176207194 20:63895438-63895460 CCCCCGGGCCGGGGCTGCGCGGG + Intronic
1176244690 20:64091850-64091872 GTGTGGGGCCGGCGCAGCCCTGG + Intronic
1176365795 21:6032123-6032145 GCGTTGGGCAGGGGCAGAGCCGG - Intergenic
1176858403 21:13987756-13987778 GGGTGGGGCCAGGGCAGGGCGGG - Intergenic
1177792576 21:25735813-25735835 CCGGGGGGACCGGGCACCGCCGG + Intronic
1178486841 21:33024944-33024966 CCTTGGGGCAGGGGCAACGCTGG - Intergenic
1178791973 21:35708900-35708922 CCGTGGGGCAGAGGCTGAGCTGG - Intronic
1179561579 21:42219186-42219208 CTGCGGGGCCGAGGCTGCGCTGG - Exonic
1179757721 21:43506422-43506444 GCGTTGGGCAGGGGCAGAGCCGG + Intergenic
1179797410 21:43793425-43793447 CCGGCGGGCGGGGGCAGCGCGGG + Intronic
1179828300 21:43980674-43980696 GCGGGTGGCCGGGGCAGTGCTGG + Intronic
1180705474 22:17807339-17807361 CAGGGGGGCAGGGGCACCGCAGG + Intronic
1181121584 22:20670918-20670940 CGATGCGGCCGGGGCAGGGCGGG + Intergenic
1181334545 22:22117942-22117964 CGATGCGGCCGGGGCAGGGCGGG + Intergenic
1181439535 22:22928682-22928704 GGGTGGAGCCTGGGCAGCGCTGG - Intergenic
1181670545 22:24423838-24423860 GGGCGGGGCGGGGGCAGCGCGGG + Intronic
1183280494 22:36929573-36929595 CCTTCGGGCTGGGGCAGAGCTGG - Intronic
1183316345 22:37139078-37139100 GGGTGGGGCTGGGGCAGGGCTGG - Intronic
1183383286 22:37501259-37501281 TCGTGGGGCCTGGGCGGGGCTGG + Intronic
1183504680 22:38202467-38202489 CCGGGAGGAAGGGGCAGCGCAGG + Intronic
1183653766 22:39173590-39173612 CCGTGGGACAGTGGCAGAGCTGG - Intergenic
1183698146 22:39434779-39434801 CAGAGGGGCCAGGGCAGGGCAGG + Intronic
1183872251 22:40748743-40748765 CGGTGGGGCTGGGGCAGCCCAGG + Intergenic
1184409459 22:44318104-44318126 CCGTGGGGGCGGGGAAGTCCAGG + Intergenic
1184766913 22:46576987-46577009 CCGCGGGGCGGGGGCGGGGCCGG + Intronic
1184770656 22:46594789-46594811 CCCTGGGGGAGGGGCAGCACGGG + Intronic
1184840185 22:47048084-47048106 CAGTGGAGCTGGGGCAGCCCGGG - Intronic
1185004651 22:48268601-48268623 CCGTGGGGCGGAGGCAAAGCAGG - Intergenic
1185181954 22:49368787-49368809 CCCTGGGGCCTGAGCAGCTCAGG - Intergenic
1185272694 22:49936094-49936116 GCGCGGGGCCGGGGCGGCGGGGG - Intergenic
953439611 3:42906418-42906440 CGGCGCGCCCGGGGCAGCGCGGG - Exonic
953576973 3:44120734-44120756 CAGTGGGGCTGGGGCAGAGTGGG - Intergenic
954540859 3:51392202-51392224 CCGCAGGGGCGGGGCAGCGACGG - Exonic
954685826 3:52369687-52369709 CTGTGGGGCAGGGGCAGTGCTGG - Intronic
954793440 3:53149176-53149198 CCTGGGGGCAGGGGCTGCGCCGG + Intergenic
954800260 3:53183211-53183233 GCCTGGGTCCGGGGCAGGGCTGG + Intronic
955829596 3:62986932-62986954 CAGTGGGGCTGGGGCAGAGTGGG - Intergenic
957096940 3:75785459-75785481 CCGTGGGCCCGGGGGATCCCGGG - Intronic
958949286 3:100399910-100399932 CCTTGGGGCTGGGGCATGGCAGG + Intronic
960586138 3:119322940-119322962 CTGCGGGGCGGGGGCAGGGCTGG - Intronic
961203438 3:125062348-125062370 CCATGGGCCCGTGACAGCGCTGG - Intergenic
961827214 3:129605476-129605498 GAGTGCGGCCGGAGCAGCGCGGG + Exonic
961828310 3:129610404-129610426 CAGTGGGGCCAGGGTTGCGCTGG + Intergenic
962454977 3:135556724-135556746 CTCTGGGGCCGGGGCAGACCAGG - Intergenic
962763749 3:138542541-138542563 CTGTGGGGCCAGGCCAGCCCAGG - Intronic
964201222 3:154121380-154121402 GCGTGGGGGCGGGCCGGCGCCGG + Intronic
967256753 3:187601055-187601077 CAGTGGGGCTTGGGCAGCCCTGG + Intergenic
967937216 3:194738714-194738736 CCCTGGGGCCTGTGCAGTGCTGG - Intergenic
968081573 3:195849918-195849940 CGCTGAGGCCGGGGCTGCGCTGG - Intergenic
968504207 4:964498-964520 CCGTGGAGACAGGGCAGGGCCGG - Intronic
968599853 4:1503738-1503760 CCGGGGAGCCGGGGGAGCCCGGG - Intergenic
968624824 4:1622421-1622443 CCGTGGGGCCAGGGCCTGGCTGG - Intronic
968640453 4:1712068-1712090 CCGTGGGGCGGGGGTTGTGCGGG - Intronic
968956254 4:3721336-3721358 CCGTGGGGCTGGGACAGCTGTGG + Intergenic
969099396 4:4757458-4757480 CCCTGGGACCTGAGCAGCGCAGG + Intergenic
969285744 4:6200761-6200783 GCGGGCGGCCGGGGCAGGGCTGG + Intergenic
969360308 4:6658982-6659004 CCGAGCCGGCGGGGCAGCGCGGG + Intergenic
969415535 4:7055516-7055538 CCGCGTGCCCGGGGCTGCGCTGG - Exonic
971223514 4:24730803-24730825 CTGTGGGGCCGAGGCAGGCCTGG + Intergenic
971424825 4:26505197-26505219 GCAGGGGGCCGGGGCAGCGGGGG + Intergenic
972321636 4:37977598-37977620 CCTTCGGGCCGGGGCTGGGCCGG + Intronic
972511273 4:39770577-39770599 CCGGGAGGCCGGGCCAGCGTGGG - Intronic
973257500 4:48128048-48128070 CTGTGGGGCCCGGGCTGCGCGGG + Intronic
977257649 4:94758270-94758292 CCGTGGGGCGGTGGCGGCGGCGG + Intronic
984734956 4:183099691-183099713 GCGGGGGGCTGGGGCGGCGCCGG + Intronic
985530175 5:429478-429500 CCAGGGGGCAGGGGCAGGGCCGG - Intronic
985536814 5:469609-469631 CCGTGGGCCCCGTGCAGTGCAGG + Intronic
987301372 5:16600582-16600604 CTGTGGGGGCGGGGCAGGGAGGG - Intronic
988466414 5:31496489-31496511 CCATGGGACTGGGGCACCGCTGG - Intronic
990954734 5:61331251-61331273 CCGAGGGGCTGAGGCAGCGAGGG + Intergenic
991587299 5:68214901-68214923 CGGGGGGGGCGGGGAAGCGCAGG - Intergenic
992150407 5:73896853-73896875 CAGAGGTGCCGGGGCAGCGGCGG + Intronic
997472281 5:134123683-134123705 CCTTGGTGCTGGGGCAGCGCTGG + Intronic
999323214 5:150627214-150627236 CCGTGGGCCCGGGGAAGTACAGG + Intronic
1001568335 5:172714635-172714657 CCGTGGGGATGGGGCAGGGTAGG - Intergenic
1001822505 5:174721098-174721120 CAGCGGGGGCGGGGCAGGGCGGG + Intergenic
1001984356 5:176061157-176061179 CCGTGGTCCTGGGGCAGCCCGGG + Intronic
1002165029 5:177338671-177338693 CTGTGGGGCAGGGGCCGTGCTGG - Intronic
1002233121 5:177782908-177782930 CCGTGGTCCTGGGGCAGCCCTGG - Intronic
1002262859 5:178006873-178006895 CCGTGGTCCTGGGGCAGCCCGGG + Intronic
1002421959 5:179153558-179153580 CCCGGGAGCTGGGGCAGCGCCGG + Exonic
1002521739 5:179796180-179796202 CCGTGGGGCCAGGGTTGCGGCGG + Intronic
1002526139 5:179817072-179817094 CGGTTGGGCCGGAGCCGCGCCGG + Intronic
1003124122 6:3341779-3341801 GGGTGGGGGCGGGGGAGCGCAGG + Intronic
1003911491 6:10747768-10747790 CCCCGGGGCCGCGGCAGGGCGGG - Exonic
1003942587 6:11044073-11044095 CGGAGGGGCCGGGTCCGCGCGGG - Intronic
1003942671 6:11044371-11044393 CCGAGGGGGCGGGGAGGCGCGGG - Intergenic
1004690225 6:17987290-17987312 CCGGGGGGCCGGGGCGGAGGCGG - Intronic
1007079417 6:39088283-39088305 TCGGGGGGCCGGGGGAGCGGGGG - Intergenic
1007406510 6:41638805-41638827 ACCTGGGCCCGGGGCTGCGCTGG - Exonic
1007465584 6:42048930-42048952 CGGCGGGGCCGGGGCAGCACGGG + Intronic
1007625383 6:43243620-43243642 CCCCGGGGCCGGGGCGGGGCGGG - Intergenic
1011633915 6:89352882-89352904 CCGGGCGGCCGCGGCAGGGCTGG - Intergenic
1012316847 6:97791409-97791431 CGGTGGGGCTGGGTCAGCCCAGG - Intergenic
1013289497 6:108708298-108708320 GCGGGGGGGCGGGGCAGAGCAGG - Intergenic
1014280838 6:119441269-119441291 CGGTGGGGCCGGGGAGGCTCAGG - Intergenic
1014551031 6:122789659-122789681 CCGGGAGGCCGGGGCTGGGCGGG + Intronic
1016982323 6:149864397-149864419 GCGCGGGGGCGGGGCCGCGCGGG - Intergenic
1017053678 6:150419005-150419027 CAGAGGGGCTGGGGCTGCGCTGG - Intergenic
1017754437 6:157517741-157517763 CCGTGAGGGCGAGGCAGGGCAGG - Intronic
1018986060 6:168638051-168638073 GGGTGGGGCAGGGGCAGGGCAGG - Intronic
1019057113 6:169231882-169231904 ACGGGGGGCGGGGGCAGCACAGG - Intronic
1019345819 7:530309-530331 CCCTGAGGACCGGGCAGCGCCGG - Intergenic
1019476427 7:1246829-1246851 CCCTGGGGTCGGGGAGGCGCCGG - Intergenic
1019505658 7:1389172-1389194 GAGAGGGGCAGGGGCAGCGCCGG + Intergenic
1019566195 7:1680206-1680228 CCGTGGGCCCAGGGCAGTGCTGG + Intergenic
1019578832 7:1750257-1750279 CCGGGGGGCCGGGGCCGGGCTGG - Intergenic
1019612998 7:1946272-1946294 GCACGGGGCCGGGGCAGCACTGG - Intronic
1019697207 7:2452460-2452482 CCGTGAGGCCGGCCCAGGGCCGG - Intergenic
1019781014 7:2939719-2939741 CCTGGGGGCGGGGCCAGCGCGGG - Intronic
1019918624 7:4149330-4149352 CAGTGGGTCCCGGGCAGCGACGG + Exonic
1019943334 7:4308258-4308280 GCGTGGGGCGAGGGCAGGGCTGG - Intergenic
1019999177 7:4745183-4745205 CCGCGGGGGCGGGGCGGCACTGG - Intronic
1020066176 7:5190209-5190231 TCGCGGGGGCGGGGCCGCGCAGG + Exonic
1021787363 7:24165122-24165144 CAGTGGGGCTGGGCCAGCCCAGG - Intergenic
1022207583 7:28179729-28179751 CCGAGGGGCCCGGGCGGGGCCGG - Intronic
1022734435 7:33062839-33062861 TCGTGGGGGCGGAGCTGCGCGGG - Intergenic
1023177636 7:37448773-37448795 GCGTGGGGCCGCGGCGGCGTGGG + Exonic
1023984963 7:45088967-45088989 CCGAGGGGCGGTGGCCGCGCAGG - Intergenic
1024920256 7:54546661-54546683 CCGCGCGGCAGGGACAGCGCCGG + Intronic
1025023618 7:55498479-55498501 ACGTGGGGTTGGGGCAGGGCAGG - Intronic
1025283791 7:57647102-57647124 CCGGGGGTCTGGGGCAGCGGTGG + Intergenic
1026850356 7:73719716-73719738 CCCGGGGGCCGGGGCGGGGCCGG - Intergenic
1026900391 7:74033790-74033812 CCGTGGGGCATGGGCGGGGCTGG - Intronic
1026909398 7:74083706-74083728 TGGTGGGGGCGGGGCCGCGCAGG + Intronic
1028135456 7:87219616-87219638 CCGAGTGGTCGGGGAAGCGCTGG + Exonic
1029058934 7:97777116-97777138 CTGTGGGGTCGGGGCGGGGCAGG - Intergenic
1029487507 7:100852597-100852619 ACGTGGAGCTGGAGCAGCGCAGG + Intronic
1029640820 7:101817602-101817624 CCGCGGCGCCGGGACAGCCCCGG + Intronic
1032199620 7:129810237-129810259 CCGTGAGGCCAGGGCAAAGCTGG + Intergenic
1033186639 7:139232074-139232096 GCGGGGGGCCGGGGCCGAGCGGG + Intronic
1033299747 7:140176160-140176182 CAGTGGGACGGGGGCAGCGGCGG - Intronic
1033372565 7:140724197-140724219 CCGTGGGGCAGGGGCAGGGGCGG - Intronic
1033662061 7:143408891-143408913 GCGGGGGGCGGGGCCAGCGCCGG + Exonic
1034392723 7:150799780-150799802 GCGTGGGGCGGGGGAAGCGGTGG - Intronic
1034422382 7:150996466-150996488 CCGGGGGGCCGGGGGAGGGCCGG - Exonic
1034475095 7:151277046-151277068 CCGTGGGGGCCGCGCGGCGCGGG + Intronic
1034562465 7:151889935-151889957 CCGTGGGTCCAGGGCAGCCGGGG + Intergenic
1034680689 7:152925478-152925500 CCGAGGGGCCGGGCGCGCGCGGG + Intergenic
1035400912 7:158564980-158565002 ACGTGGGGCAGGGCCTGCGCAGG - Intronic
1035418344 7:158707401-158707423 CGGTGGGGCCGGGACAGCCAAGG - Intergenic
1035728365 8:1838728-1838750 CCGTGGGGACTGTGCAGCGTGGG + Intronic
1036950265 8:13133337-13133359 CCGAGGGGCGGGGCCAGAGCGGG + Intronic
1037815470 8:22109522-22109544 CCGAGGGGGCGGGGCCGCCCGGG + Intergenic
1039880454 8:41622233-41622255 CAGAGGGGCCGGGGCGGGGCAGG + Exonic
1040804379 8:51377813-51377835 CCGGGAGGCTGGGGCTGCGCAGG - Intronic
1041658360 8:60376550-60376572 CCGTGGGGCCTCGGGAGCCCTGG + Intergenic
1042040216 8:64581379-64581401 CCGGGGGGCCTGGGCGGCGGCGG + Exonic
1042271756 8:66962396-66962418 CTGTGTGGCCAGGGCCGCGCTGG + Exonic
1043296130 8:78665987-78666009 CCGTGGGGGCGGGGCCGCGGCGG - Intergenic
1044963957 8:97557215-97557237 CCGGGAGGCTAGGGCAGCGCAGG - Intergenic
1045582841 8:103499553-103499575 CCGAGGGACCGGGGCGGGGCGGG - Intergenic
1048494134 8:134921253-134921275 CCGTGTGGCTGGGTCAGGGCTGG + Intergenic
1049109688 8:140635364-140635386 CCGCGGGGTCGGGGCGGCGGGGG - Intronic
1049283145 8:141760738-141760760 CCCAGGGGCCGGGGCCGCGAGGG - Intergenic
1049411907 8:142477320-142477342 GCGGGGGGCCAGGGCAGCGGGGG + Intronic
1049471591 8:142777310-142777332 AGGTGGGGCCGGGGCAGGCCTGG - Intronic
1049562082 8:143316974-143316996 CCTTGGAGCTGGGGCAGCACTGG - Intronic
1049595944 8:143483418-143483440 CCGTGAGGCTGGGGCAATGCAGG + Intronic
1049611897 8:143559697-143559719 CCCTGGGGCTGGGACAGGGCTGG + Intronic
1049732295 8:144184912-144184934 CTATGGGGCTGGGGCAGAGCAGG + Intronic
1049800400 8:144514974-144514996 ACGTGAGGCAGGGGCTGCGCCGG + Exonic
1049828501 8:144685437-144685459 TCGAGGGGCCGAGGCCGCGCGGG - Intergenic
1051936476 9:22447626-22447648 CCCTGCGGCGGGGGCTGCGCTGG + Exonic
1052824661 9:33166531-33166553 GCGTGGGGCCGGGACCGCACAGG - Intronic
1055321603 9:75088212-75088234 CCGTTGGGGCGGGGCGGGGCGGG + Intronic
1056369719 9:85941540-85941562 CAGTGGGACCGGGGCTGGGCTGG + Intronic
1056524182 9:87427416-87427438 GCTTGGGGCAGGGGCAGGGCGGG + Intergenic
1057466252 9:95317267-95317289 CCGCGGGGCGGGGCCAGGGCGGG - Intronic
1057489576 9:95510885-95510907 CCGCGCGGCCGGGGCAGAGTAGG + Intronic
1059176731 9:112175142-112175164 CCGCGGCGCCGCGGGAGCGCCGG - Exonic
1059191862 9:112333938-112333960 CCGCGGGGCCGCGGGAGGGCGGG - Intergenic
1059414735 9:114155810-114155832 CCCTGGGCGCGGGGCTGCGCTGG + Exonic
1059416103 9:114163512-114163534 CCAGGGGGCCGGGGCAGCGATGG + Intronic
1060161534 9:121369685-121369707 CCCTGGGGCCAGGCCAGGGCTGG + Intronic
1060544832 9:124453683-124453705 GGGTGGGGCCGGGGCGGGGCGGG - Intronic
1060832034 9:126722963-126722985 ACCTGGGGCCTGGGCAGCGCGGG - Intergenic
1060832066 9:126723059-126723081 CCGAGTGCCTGGGGCAGCGCTGG - Intergenic
1061005669 9:127927498-127927520 ACGTGGGGGCGGGGCACCACTGG - Intronic
1061185349 9:129049691-129049713 CCGTGTGGCCTGGGCTGCTCAGG - Intronic
1061487964 9:130929812-130929834 CGGTGAGGTCGGGGCAGCGCGGG + Exonic
1061883008 9:133577360-133577382 CCGGGGGGCCGGGGCTGCGAGGG + Intergenic
1062022726 9:134326844-134326866 TCGCGGGGCCGGGGCGGGGCTGG + Intronic
1062292622 9:135803721-135803743 CTGTGGGGAAGGGGCAGGGCAGG + Intergenic
1062331503 9:136046832-136046854 CCATGGGGCGGGGGCTGTGCCGG + Intronic
1062344649 9:136109232-136109254 CCCTGGGCCCGGGTCACCGCTGG + Intergenic
1062464693 9:136675817-136675839 CCGTGAGGCCTGGGGAGCCCCGG - Intronic
1062472505 9:136712631-136712653 CCGCGGGGCCCGCGCAGCCCCGG + Exonic
1062540855 9:137041033-137041055 CCGTGGGGCAGGGGAAGCGGGGG + Intronic
1062560470 9:137139385-137139407 CCGCGGGGCCGGGCGAGCGCAGG + Intronic
1062690183 9:137837590-137837612 CAGGTGGGCCGGGGCAGGGCAGG + Intronic
1062696215 9:137877648-137877670 CGGAGGGGCCGGGGCGGGGCGGG + Intergenic
1203792897 EBV:161066-161088 GGGTGGGCCCGGGGCAGCCCAGG - Intergenic
1203661270 Un_KI270753v1:45791-45813 CCGTAGGGCAGAGGCAGAGCCGG + Intergenic
1186425983 X:9464879-9464901 CCGCGGGGGAGGGGCAGGGCCGG + Intronic
1187547302 X:20266699-20266721 CCGTGGGGCTCGGGCGGCGACGG - Exonic
1189069273 X:37847230-37847252 CGGTGGGGTCGGGGCAGGGTTGG - Intronic
1190109570 X:47581415-47581437 CCATGGGGAGGGGGCAGGGCAGG + Intronic
1191053888 X:56222695-56222717 CCGTGGGGGCAGGGCATGGCGGG + Intergenic
1191846573 X:65551617-65551639 CCGTGGGGCCAGGGCCGGGCCGG - Intergenic
1192361702 X:70444983-70445005 CCGTGGGTGCGGGGCAGCGTGGG + Exonic
1194387857 X:93278713-93278735 GGGTGGGGGCGGGGCAGGGCAGG + Intergenic
1196463326 X:115950561-115950583 CCGGGGGGCAGGGCCAGGGCTGG - Intergenic
1197806370 X:130402124-130402146 CCGAGGGGCGGGAGCGGCGCGGG + Intronic
1199736919 X:150693687-150693709 GCGGGAGGCCGGGGCAGCCCGGG - Intronic
1199875506 X:151924638-151924660 CTGTGGGGAAGGGGCAGGGCTGG + Exonic
1199881024 X:151974439-151974461 CGGTAGGGCCGGGGCAAAGCGGG + Intronic
1200177415 X:154126542-154126564 CCGTGGGCCTGGGGCAGTGGTGG + Intergenic
1200402670 X:156028745-156028767 TCGTGGCGCCGGGGCACTGCAGG - Intergenic