ID: 930224845

View in Genome Browser
Species Human (GRCh38)
Location 2:48781519-48781541
Sequence CTGGTTTACCAGCACAGCAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
930224845_930224847 -7 Left 930224845 2:48781519-48781541 CCAGTGCTGTGCTGGTAAACCAG No data
Right 930224847 2:48781535-48781557 AAACCAGCTCTCTGGAAAAGAGG No data
930224845_930224851 26 Left 930224845 2:48781519-48781541 CCAGTGCTGTGCTGGTAAACCAG No data
Right 930224851 2:48781568-48781590 AGGAAATGGCAGAGCCAGACAGG No data
930224845_930224849 6 Left 930224845 2:48781519-48781541 CCAGTGCTGTGCTGGTAAACCAG No data
Right 930224849 2:48781548-48781570 GGAAAAGAGGTTAAGTAATTAGG No data
930224845_930224850 12 Left 930224845 2:48781519-48781541 CCAGTGCTGTGCTGGTAAACCAG No data
Right 930224850 2:48781554-48781576 GAGGTTAAGTAATTAGGAAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
930224845 Original CRISPR CTGGTTTACCAGCACAGCAC TGG (reversed) Intergenic
No off target data available for this crispr