ID: 930228259

View in Genome Browser
Species Human (GRCh38)
Location 2:48816634-48816656
Sequence GTGCAGTTCTTAAGGGAGAA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
930228256_930228259 -7 Left 930228256 2:48816618-48816640 CCTTTTTATGTTAGGAGTGCAGT No data
Right 930228259 2:48816634-48816656 GTGCAGTTCTTAAGGGAGAAAGG No data
930228253_930228259 17 Left 930228253 2:48816594-48816616 CCATGCAAAGGACATGATCTTCC No data
Right 930228259 2:48816634-48816656 GTGCAGTTCTTAAGGGAGAAAGG No data
930228251_930228259 27 Left 930228251 2:48816584-48816606 CCATCCATGTCCATGCAAAGGAC No data
Right 930228259 2:48816634-48816656 GTGCAGTTCTTAAGGGAGAAAGG No data
930228255_930228259 -4 Left 930228255 2:48816615-48816637 CCTCCTTTTTATGTTAGGAGTGC No data
Right 930228259 2:48816634-48816656 GTGCAGTTCTTAAGGGAGAAAGG No data
930228252_930228259 23 Left 930228252 2:48816588-48816610 CCATGTCCATGCAAAGGACATGA 0: 63
1: 7107
2: 23564
3: 11739
4: 6473
Right 930228259 2:48816634-48816656 GTGCAGTTCTTAAGGGAGAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
930228259 Original CRISPR GTGCAGTTCTTAAGGGAGAA AGG Intergenic
No off target data available for this crispr