ID: 930231272

View in Genome Browser
Species Human (GRCh38)
Location 2:48846316-48846338
Sequence TATTTCATGGAGCAGGTGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
930231268_930231272 -8 Left 930231268 2:48846301-48846323 CCTTTGGCTAGGAATTATTTCAT No data
Right 930231272 2:48846316-48846338 TATTTCATGGAGCAGGTGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
930231272 Original CRISPR TATTTCATGGAGCAGGTGGA AGG Intergenic
No off target data available for this crispr