ID: 930231421

View in Genome Browser
Species Human (GRCh38)
Location 2:48847596-48847618
Sequence CTGATATATACTGGGAATGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
930231421_930231430 2 Left 930231421 2:48847596-48847618 CCTGCATTCCCAGTATATATCAG No data
Right 930231430 2:48847621-48847643 CCAAAAGGGTAAGGACCGTTTGG No data
930231421_930231428 -7 Left 930231421 2:48847596-48847618 CCTGCATTCCCAGTATATATCAG No data
Right 930231428 2:48847612-48847634 ATATCAGGGCCAAAAGGGTAAGG No data
930231421_930231431 11 Left 930231421 2:48847596-48847618 CCTGCATTCCCAGTATATATCAG No data
Right 930231431 2:48847630-48847652 TAAGGACCGTTTGGTCATGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
930231421 Original CRISPR CTGATATATACTGGGAATGC AGG (reversed) Intergenic
No off target data available for this crispr