ID: 930232779

View in Genome Browser
Species Human (GRCh38)
Location 2:48859551-48859573
Sequence CTGCCCTCTATGAATTGGGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
930232779_930232785 17 Left 930232779 2:48859551-48859573 CCACCCCAATTCATAGAGGGCAG No data
Right 930232785 2:48859591-48859613 TAAATAATACCCCTCTCTTTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
930232779 Original CRISPR CTGCCCTCTATGAATTGGGG TGG (reversed) Intergenic
No off target data available for this crispr