ID: 930234244

View in Genome Browser
Species Human (GRCh38)
Location 2:48873720-48873742
Sequence CTTCACTGCAGCCCAGCTGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
930234244_930234247 -10 Left 930234244 2:48873720-48873742 CCAGCAGCTGGGCTGCAGTGAAG No data
Right 930234247 2:48873733-48873755 TGCAGTGAAGAGATGGAGGCAGG No data
930234244_930234248 -5 Left 930234244 2:48873720-48873742 CCAGCAGCTGGGCTGCAGTGAAG No data
Right 930234248 2:48873738-48873760 TGAAGAGATGGAGGCAGGTCAGG No data
930234244_930234249 7 Left 930234244 2:48873720-48873742 CCAGCAGCTGGGCTGCAGTGAAG No data
Right 930234249 2:48873750-48873772 GGCAGGTCAGGCAGACCTTGTGG No data
930234244_930234251 25 Left 930234244 2:48873720-48873742 CCAGCAGCTGGGCTGCAGTGAAG No data
Right 930234251 2:48873768-48873790 TGTGGCCCTAGAACTGAGTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
930234244 Original CRISPR CTTCACTGCAGCCCAGCTGC TGG (reversed) Intergenic
No off target data available for this crispr