ID: 930235786

View in Genome Browser
Species Human (GRCh38)
Location 2:48887807-48887829
Sequence CAGCTGTTGTAGGGGGGAAA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
930235769_930235786 28 Left 930235769 2:48887756-48887778 CCTAAATGTCTGATCTGGAGGAG No data
Right 930235786 2:48887807-48887829 CAGCTGTTGTAGGGGGGAAAAGG No data
930235768_930235786 29 Left 930235768 2:48887755-48887777 CCCTAAATGTCTGATCTGGAGGA No data
Right 930235786 2:48887807-48887829 CAGCTGTTGTAGGGGGGAAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
930235786 Original CRISPR CAGCTGTTGTAGGGGGGAAA AGG Intergenic
No off target data available for this crispr