ID: 930240061

View in Genome Browser
Species Human (GRCh38)
Location 2:48927176-48927198
Sequence TTATGCAGCTGGGAATAAAA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
930240056_930240061 22 Left 930240056 2:48927131-48927153 CCAACTCAGCCTTTAATTAGAGC No data
Right 930240061 2:48927176-48927198 TTATGCAGCTGGGAATAAAATGG No data
930240057_930240061 13 Left 930240057 2:48927140-48927162 CCTTTAATTAGAGCTATGCACAG No data
Right 930240061 2:48927176-48927198 TTATGCAGCTGGGAATAAAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
930240061 Original CRISPR TTATGCAGCTGGGAATAAAA TGG Intergenic
No off target data available for this crispr