ID: 930240644

View in Genome Browser
Species Human (GRCh38)
Location 2:48932639-48932661
Sequence ATGAACAAACAGTCTAATTA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
930240640_930240644 -7 Left 930240640 2:48932623-48932645 CCTTCCCCTGCTTTCAATGAACA No data
Right 930240644 2:48932639-48932661 ATGAACAAACAGTCTAATTAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
930240644 Original CRISPR ATGAACAAACAGTCTAATTA AGG Intergenic
No off target data available for this crispr