ID: 930241330

View in Genome Browser
Species Human (GRCh38)
Location 2:48938385-48938407
Sequence GAGTATGCACACAGGGCTCT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
930241323_930241330 27 Left 930241323 2:48938335-48938357 CCTATCACGCCATCACACTCTCA No data
Right 930241330 2:48938385-48938407 GAGTATGCACACAGGGCTCTGGG No data
930241326_930241330 18 Left 930241326 2:48938344-48938366 CCATCACACTCTCACACACGGGC No data
Right 930241330 2:48938385-48938407 GAGTATGCACACAGGGCTCTGGG No data
930241322_930241330 28 Left 930241322 2:48938334-48938356 CCCTATCACGCCATCACACTCTC No data
Right 930241330 2:48938385-48938407 GAGTATGCACACAGGGCTCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
930241330 Original CRISPR GAGTATGCACACAGGGCTCT GGG Intergenic
No off target data available for this crispr