ID: 930241330 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 2:48938385-48938407 |
| Sequence | GAGTATGCACACAGGGCTCT GGG |
| Strand | + |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | No data | |||
| Summary | No data |
Found 3 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 930241323_930241330 | 27 | Left | 930241323 | 2:48938335-48938357 | CCTATCACGCCATCACACTCTCA | No data | ||
| Right | 930241330 | 2:48938385-48938407 | GAGTATGCACACAGGGCTCTGGG | No data | ||||
| 930241326_930241330 | 18 | Left | 930241326 | 2:48938344-48938366 | CCATCACACTCTCACACACGGGC | No data | ||
| Right | 930241330 | 2:48938385-48938407 | GAGTATGCACACAGGGCTCTGGG | No data | ||||
| 930241322_930241330 | 28 | Left | 930241322 | 2:48938334-48938356 | CCCTATCACGCCATCACACTCTC | No data | ||
| Right | 930241330 | 2:48938385-48938407 | GAGTATGCACACAGGGCTCTGGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 930241330 | Original CRISPR | GAGTATGCACACAGGGCTCT GGG | Intergenic | ||
| No off target data available for this crispr | |||||