ID: 930247255

View in Genome Browser
Species Human (GRCh38)
Location 2:48997133-48997155
Sequence CCAGTGGTCTCTCTAGCTTC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 483
Summary {0: 1, 1: 0, 2: 3, 3: 30, 4: 449}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
930247255 Original CRISPR CCAGTGGTCTCTCTAGCTTC TGG Intronic
900915509 1:5635491-5635513 CCAGTGGTCTTTGTACCTTTTGG - Intergenic
901125767 1:6927710-6927732 CCACTGGTCCCACTAGCTTGAGG - Intronic
901429520 1:9204557-9204579 CCAGGCCTCTCTCCAGCTTCTGG + Intergenic
901758950 1:11458416-11458438 CCAGGAGTGTCTCCAGCTTCTGG - Intergenic
901763431 1:11485234-11485256 CAAGTGGTCTCTCCAGGGTCAGG + Intronic
902179522 1:14677471-14677493 CCAGTGGTCTCTTTGGCCTGTGG + Intronic
903261789 1:22135627-22135649 CCTGTGGTCTCTGTAGCTGTTGG + Intronic
905186052 1:36197594-36197616 CTCGTGGTCTCGCTGGCTTCAGG - Intergenic
905892444 1:41525910-41525932 CCAGTGGCCTCTCAGGCTTCAGG - Intronic
908078102 1:60543203-60543225 TCCCTGGTCTCTTTAGCTTCTGG + Intergenic
908683463 1:66688337-66688359 CCAGTGGGGTCTCTGGATTCAGG - Intronic
908769962 1:67586985-67587007 CCATTTCTCTCTCTAACTTCAGG + Intergenic
908823776 1:68114656-68114678 CCAGTGGTCACTCCATCATCTGG - Intronic
908888750 1:68818793-68818815 TCTGTGGTCTCGCTGGCTTCAGG - Intergenic
910044780 1:82899259-82899281 CCTGTTGTCTCTCTAGCTCTAGG + Intergenic
911259440 1:95668988-95669010 CTCGTGGTCTCGCTGGCTTCAGG + Intergenic
912057951 1:105630385-105630407 CTCGTGGTCTCGCTGGCTTCAGG + Intergenic
912316071 1:108668447-108668469 CTCGTGGTCTCGCTGGCTTCAGG - Intergenic
913160904 1:116145823-116145845 CTTGTGGTCTCGCTGGCTTCAGG + Intergenic
914438285 1:147680103-147680125 CTCGTGGTCTCGCTGGCTTCAGG + Intergenic
915260216 1:154671726-154671748 CTCATGGTCTCGCTAGCTTCAGG - Intergenic
915261385 1:154679038-154679060 CTCGTGGTCTCGCTGGCTTCAGG - Intergenic
915764340 1:158348376-158348398 CTCGTGGTCTCGCTGGCTTCAGG + Intergenic
915766998 1:158373384-158373406 CTCGTGGTCTCGCTGGCTTCAGG + Intergenic
916220025 1:162434174-162434196 CTCGTGGTCTCGCTGGCTTCAGG - Intergenic
916336081 1:163672618-163672640 CCACTGGTCTGTGTAGCTTCTGG + Intergenic
916600949 1:166293074-166293096 CTAGTGGACTCTCCAGCTTTGGG + Intergenic
917406473 1:174712363-174712385 TTCGTGGTCTCACTAGCTTCAGG - Intronic
918059162 1:181046797-181046819 CTCGTGGTCTCGCTGGCTTCAGG - Intronic
918696275 1:187550478-187550500 TTCGTGGTCTCGCTAGCTTCAGG + Intergenic
918709095 1:187704581-187704603 CTCGTGGTCTCGCTGGCTTCAGG - Intergenic
920108154 1:203569045-203569067 CCATTGGCCTCTCTAGCCTGGGG + Intergenic
920756831 1:208740646-208740668 CTCGTGGTCTCACTGGCTTCAGG - Intergenic
920944374 1:210514868-210514890 CCACTGCTCTCTCTAACTACAGG - Intronic
922056974 1:222050718-222050740 CTCGTGGTCTCGCTGGCTTCAGG - Intergenic
923200185 1:231703884-231703906 CCAGTGTTTTCTCAAGCCTCAGG - Intronic
923559177 1:235025480-235025502 CCTGTGGTCTCCTCAGCTTCTGG - Intergenic
923574017 1:235141705-235141727 CTCGTGGTCTCGCTGGCTTCAGG - Intronic
924443477 1:244105703-244105725 CCAGTTCGCTCTCTAACTTCTGG + Intergenic
1063148808 10:3319245-3319267 TTCGTGGTCTCTCTGGCTTCAGG + Intergenic
1063318570 10:5031873-5031895 CTCGTGGTCTCACTGGCTTCAGG + Intronic
1063383860 10:5603749-5603771 ACATTGGTCTCTCTGGCTTTGGG + Intergenic
1065181601 10:23131748-23131770 CCAGTGGTCTCGCTAGCACACGG - Intergenic
1065578441 10:27147735-27147757 CCCGTGGTTTCTATAGCATCTGG + Intronic
1065925456 10:30431393-30431415 GCAGGGTTCTCTCTTGCTTCTGG - Intergenic
1066190426 10:33050314-33050336 CTCGTGGTCTCGCTGGCTTCAGG - Intergenic
1066235306 10:33479857-33479879 CTTGTGGTCTCGCTGGCTTCAGG + Intergenic
1068752652 10:60612826-60612848 CCAGTAGTCTTTGTATCTTCTGG + Intronic
1069684724 10:70310340-70310362 CCACTGGGCTGTCTAGCCTCAGG - Intronic
1069766292 10:70862633-70862655 CTCGTGGTCTCACTGGCTTCAGG - Intronic
1071055457 10:81503878-81503900 CTCGTGGTCTCGCTGGCTTCAGG - Intergenic
1071669754 10:87597489-87597511 CCAGTGGTGCCTGTAGCTTCTGG - Intergenic
1073365993 10:102941518-102941540 CCAGAGGTCACTGTAGCTGCTGG - Intronic
1074500015 10:114014748-114014770 TCTGTAGTCTCTCTAGGTTCTGG - Intergenic
1074753092 10:116606008-116606030 CCTGTGGTCTCCCTGGCTTTGGG + Intronic
1075537364 10:123282744-123282766 CTCGTGGTCTCGCTGGCTTCAGG + Intergenic
1076784832 10:132744631-132744653 CCTGTGGTGTTTCTAGATTCGGG + Intronic
1077640211 11:3874522-3874544 CCAGGTCTCTCCCTAGCTTCAGG + Intronic
1078451220 11:11442488-11442510 CCAGATGTCTCTCTAGAGTCTGG + Intronic
1078451519 11:11444071-11444093 CCAGATGTCTCTCTAGAGTCTGG + Intronic
1078730870 11:13972880-13972902 CCAGGGGTGGCTCTTGCTTCAGG + Intronic
1078862059 11:15257768-15257790 CCAGGCCTCTCTCTAGCTTCTGG - Intergenic
1080119658 11:28662584-28662606 TCACTGGTCTCCCTAGCTACTGG + Intergenic
1081047534 11:38295669-38295691 TTCGTGGTCTCTCTGGCTTCAGG + Intergenic
1081421077 11:42875121-42875143 CTCGTGGTCTCGCTGGCTTCAGG - Intergenic
1081676186 11:44971097-44971119 GCGGTGGTCTCTCAAGGTTCTGG + Intergenic
1083847674 11:65345467-65345489 CCGTGGGGCTCTCTAGCTTCTGG - Intronic
1084210629 11:67620128-67620150 CTTGTGGTCTCGCTGGCTTCAGG - Intergenic
1084378927 11:68798353-68798375 GGAGGGGTCTCTCTAGCCTCAGG - Intronic
1084450249 11:69232591-69232613 CCAGGCCTCTCTCCAGCTTCTGG - Intergenic
1084639747 11:70418140-70418162 CCAGTGGTGTTTCTTGCTTTGGG - Intronic
1084644898 11:70450837-70450859 CCAGAGGTACCTCTACCTTCAGG + Intergenic
1085245747 11:75099130-75099152 CTTGTGGTCTCGCTGGCTTCAGG - Intergenic
1085245759 11:75099228-75099250 CTAGTGGTCTCACTGGCTTCAGG - Intergenic
1085687869 11:78640190-78640212 CTCGTGGTCTCACTGGCTTCAGG - Intergenic
1086035061 11:82404922-82404944 TTTGTGGTCTCTCTGGCTTCAGG - Intergenic
1087100298 11:94357271-94357293 CCTGGGGTCTCTCTAGCTTTTGG + Intergenic
1087220899 11:95545325-95545347 CCAGTGGACTCAATAGGTTCAGG - Intergenic
1087401171 11:97668121-97668143 TTCGTGGTCTCTCTGGCTTCAGG - Intergenic
1087486217 11:98762635-98762657 CTCGTGGTCTCGCTGGCTTCAGG + Intergenic
1088571024 11:111222949-111222971 CTCGTGGTCTCGCTGGCTTCAGG - Intergenic
1088959789 11:114651381-114651403 CTCGTGGTCTCGCTGGCTTCAGG + Intergenic
1090239107 11:125169578-125169600 CCAGTGGGTCATCTAGCTTCTGG + Intronic
1091474898 12:763103-763125 TCAGTAGTGTCTGTAGCTTCAGG - Intronic
1092172467 12:6382753-6382775 ACACTGGTCTGTCTAACTTCAGG - Intronic
1092350379 12:7751490-7751512 CTTGTGGTCTTGCTAGCTTCAGG + Intronic
1092471945 12:8788394-8788416 CTCGTGGTCTCGCTGGCTTCAGG - Intergenic
1092473140 12:8795853-8795875 CTCGTGGTCTCGCTGGCTTCAGG - Intergenic
1092616971 12:10224769-10224791 CTCGTGGTCTCGCTGGCTTCAGG + Intergenic
1092834082 12:12471872-12471894 CTCGTGGTCTCGCTGGCTTCAGG + Intergenic
1092865567 12:12757810-12757832 CCACTGGTATCTGTAGTTTCAGG + Intronic
1093034671 12:14321185-14321207 CTCGTGGTCTCGCTGGCTTCAGG - Intergenic
1093034684 12:14321287-14321309 CTGGTGGTCTCACTGGCTTCAGG - Intergenic
1093189558 12:16058348-16058370 CTCGTGGTCTCGCTGGCTTCAGG - Intergenic
1093580891 12:20783170-20783192 CTTGTGGTCTCACTGGCTTCAGG + Intergenic
1094327711 12:29257615-29257637 CTCGTGGTCTCGCTGGCTTCAGG - Intronic
1096533761 12:52258087-52258109 CCAGTGGTCTCTCTAGAAATGGG - Intronic
1096654024 12:53077329-53077351 CCAGTGCCTTCTCTACCTTCTGG - Intronic
1100166468 12:91923289-91923311 TTCGTGGTCTCTCTGGCTTCAGG + Intergenic
1100284753 12:93154703-93154725 TCACTGGTCTCTCTAACTCCAGG + Intergenic
1101009148 12:100431270-100431292 CTCGTGGTCTCGCTGGCTTCAGG - Intergenic
1102309908 12:111836637-111836659 TTTGTGGTCTCTCTGGCTTCAGG - Intergenic
1103678567 12:122676013-122676035 CTCGTGGTCTCTCTGGCTTCAGG + Intergenic
1103783237 12:123413501-123413523 CTCCTGGTCTCCCTAGCTTCAGG + Exonic
1103919829 12:124393506-124393528 CCGGTGGCCCCTCTACCTTCTGG + Intronic
1104329008 12:127826644-127826666 CTGGTGGTCTCGCTGGCTTCAGG + Intergenic
1107590276 13:41897690-41897712 CTCGTGGTCTCGCTGGCTTCAGG + Intronic
1108435493 13:50397558-50397580 CTTGTGGTCTCGCTGGCTTCAGG - Intronic
1109159713 13:58957534-58957556 CTCGTGGTCTCGCTGGCTTCAGG + Intergenic
1109858950 13:68171889-68171911 TTCGTGGTCTCTCTGGCTTCAGG - Intergenic
1110528502 13:76568540-76568562 ACAGTGATCTAACTAGCTTCAGG + Intergenic
1110940121 13:81340043-81340065 CTCGTGGTCTCGCTGGCTTCAGG + Intergenic
1110940137 13:81340145-81340167 CTCGTGGTCTCACTGGCTTCAGG + Intergenic
1111356174 13:87105839-87105861 TCACTGCTCTTTCTAGCTTCTGG - Intergenic
1111591184 13:90349503-90349525 CTCGTGGTCTCGCTGGCTTCAGG - Intergenic
1112049587 13:95632400-95632422 CCAGGGTCCTCTGTAGCTTCTGG + Intronic
1112204465 13:97310225-97310247 CACGTTCTCTCTCTAGCTTCAGG + Intronic
1112613254 13:100976668-100976690 CTCGTGGTCTCGCTGGCTTCAGG - Intergenic
1113482518 13:110632257-110632279 CTCGTGGTCTCGCTGGCTTCAGG + Intronic
1116311166 14:43327763-43327785 CTCGTGGTCTCGCTGGCTTCAGG - Intergenic
1116452523 14:45081531-45081553 CCCGTGGTCTCGCTGGCTTCAGG - Intergenic
1118932564 14:70255874-70255896 TTCGTGGTCTCTCTGGCTTCAGG - Intergenic
1119694973 14:76706160-76706182 TTAGTGGTCTCCCTGGCTTCAGG + Intergenic
1120844301 14:89112570-89112592 CTCGTGGTCTCGCTGGCTTCAGG - Intergenic
1121182010 14:91936190-91936212 CCAATGGTCTCTCAAACTTTTGG + Intronic
1121287864 14:92750529-92750551 CTTGTGGTCTCCCTGGCTTCAGG - Intergenic
1121731246 14:96188687-96188709 CCAGGCCTCTCTGTAGCTTCTGG - Intergenic
1122298236 14:100717452-100717474 CCACTCTTCTCTCTAGCTGCAGG + Intergenic
1122351968 14:101101543-101101565 CCAGGCTTCTCTCCAGCTTCTGG - Intergenic
1123800897 15:23819386-23819408 CCAGGGGTGTCACTACCTTCTGG + Intergenic
1124114686 15:26830407-26830429 CTTGTGGTCTCGCTGGCTTCGGG + Intronic
1125631723 15:41152568-41152590 TTCGTGGTCTCGCTAGCTTCAGG - Intergenic
1127028350 15:54833483-54833505 CCCGTGGTGTCTCCAGCTTTGGG - Intergenic
1128669834 15:69566746-69566768 CTCGTGGTCTCGCTGGCTTCAGG + Intergenic
1128728579 15:70005839-70005861 CCAGTAGGCTCTCTGCCTTCTGG + Intergenic
1129197069 15:73974717-73974739 TTCGTGGTCTCGCTAGCTTCAGG - Intergenic
1129997300 15:80017525-80017547 CTCGTGGTCTCACTGGCTTCAGG - Intergenic
1130045769 15:80443486-80443508 CGAGAGGTCTCTCCATCTTCTGG - Intronic
1130133029 15:81159680-81159702 TCAGTGATCTCGCTGGCTTCAGG - Intronic
1132286905 15:100670004-100670026 CCAGGCCTCTCTCTAGCTTCGGG + Intergenic
1132868375 16:2104740-2104762 CAAGTGGGCTCTCCAGCTGCAGG - Intronic
1133031274 16:3012414-3012436 CCAGTGGCCCCGCTAGCTCCCGG - Intergenic
1133367379 16:5221363-5221385 CTCGTGGTCTCGCTGGCTTCAGG + Intergenic
1134049292 16:11125817-11125839 CCACTGGTCTCTGCAGCTTGAGG + Intronic
1134523356 16:14928261-14928283 CAAGTGGGCTCTCCAGCTGCAGG + Intronic
1134710948 16:16326745-16326767 CAAGTGGGCTCTCCAGCTGCAGG + Intergenic
1134948635 16:18341864-18341886 CAAGTGGGCTCTCCAGCTGCAGG - Intergenic
1135193430 16:20374378-20374400 CCAGTGTTTTCTCTTGCTCCAGG - Intronic
1135613374 16:23888193-23888215 TCAATGCTCTCTCTAGTTTCAGG + Intronic
1138346126 16:56321299-56321321 CCAGAGGTCTCTGTGGCTGCAGG + Intronic
1139603194 16:67999187-67999209 CTTGTGGTCTCGCTGGCTTCAGG - Intronic
1140389292 16:74571461-74571483 CCAGTCTGGTCTCTAGCTTCTGG - Intronic
1140594031 16:76387423-76387445 CCAATAGTCTCTCTTGCTTTAGG + Intronic
1141154251 16:81586041-81586063 CCATTGCTCCCTCTAGCTTCAGG + Intronic
1142807945 17:2381291-2381313 CCAGTGGCCCCTCTAGCCTGTGG + Intergenic
1142986592 17:3698751-3698773 CATGTGGTCTCTAAAGCTTCAGG - Intergenic
1143456565 17:7071676-7071698 CAAGTGGTCTCTGTGGCTGCAGG + Intergenic
1143917081 17:10302018-10302040 CCATTGGTCTCTATACCTTCAGG - Intronic
1144765349 17:17729509-17729531 CCAGCGATCTCACTTGCTTCTGG - Intronic
1145094960 17:20017287-20017309 TTCGTGGTCTCGCTAGCTTCAGG - Intronic
1146740325 17:35278433-35278455 CTCGTGGTCTCGCTGGCTTCAGG + Intergenic
1148017017 17:44528945-44528967 CTCGTGGTCTCGCTGGCTTCAGG - Intergenic
1148825200 17:50387990-50388012 CCAGTGGATTCTCATGCTTCAGG - Intronic
1150804484 17:68308469-68308491 CTCGTGGTCTCGCTGGCTTCAGG + Intronic
1151579777 17:74971562-74971584 CCAGGGCTCTCTCTTGCTGCTGG - Intronic
1152046636 17:77940997-77941019 CAAGAGGTCTCTCTACCTGCGGG - Intergenic
1153151667 18:2102188-2102210 GCTGTGGTCTCTCTAGCTGATGG + Intergenic
1153643892 18:7177935-7177957 CTCGTGGTCTCGCTGGCTTCAGG + Intergenic
1155294883 18:24375967-24375989 CTCGTGGTCTCCCTGGCTTCAGG + Intronic
1155435985 18:25813554-25813576 CCCATGGTCTCTCTTGCTCCAGG + Intergenic
1158017169 18:52797779-52797801 CCAGTGGTATATGTAGCTGCTGG + Intronic
1158460496 18:57642243-57642265 TTCGTGGTCTCGCTAGCTTCAGG + Intergenic
1158460509 18:57642345-57642367 TTCGTGGTCTCGCTAGCTTCAGG + Intergenic
1158460522 18:57642447-57642469 TTCGTGGTCTCGCTAGCTTCAGG + Intergenic
1158460535 18:57642549-57642571 TTCGTGGTCTCGCTAGCTTCAGG + Intergenic
1158460547 18:57642651-57642673 TTCGTGGTCTCGCTAGCTTCAGG + Intergenic
1158460559 18:57642753-57642775 TTCGTGGTCTCGCTAGCTTCAGG + Intergenic
1158460570 18:57642855-57642877 TTTGTGGTCTCGCTAGCTTCAGG + Intergenic
1159167806 18:64725028-64725050 CCCGTGGTCTTGCTGGCTTCAGG + Intergenic
1159230963 18:65606219-65606241 CTCGTGGTCTCACTGGCTTCAGG - Intergenic
1159260326 18:66005129-66005151 TTTGTGGTCTCGCTAGCTTCAGG + Intergenic
1159289396 18:66396315-66396337 GCTGTGGTCTCGCTGGCTTCAGG - Intergenic
1160121613 18:76135332-76135354 CCAGTGGTTTGTTCAGCTTCTGG + Intergenic
1160176449 18:76599280-76599302 CTCGTGGTCTCGCTGGCTTCAGG + Intergenic
1160415392 18:78706384-78706406 CCTGGGCTCTCTCTGGCTTCCGG - Intergenic
1160449208 18:78950614-78950636 CCAGGGCCCTCTCCAGCTTCTGG - Intergenic
1162232939 19:9282722-9282744 CTCGTGGTCTCGCTGGCTTCAGG + Intergenic
1162237891 19:9322569-9322591 CTCGTGGTCTCGCTGGCTTCAGG - Intergenic
1162814566 19:13185981-13186003 CTGGTGGTCTCCCTGGCTTCAGG + Intergenic
1163181557 19:15607878-15607900 CTCGTGGTCTCGCTGGCTTCAGG + Intergenic
1164643246 19:29841642-29841664 CCAGGGGCCTATCTAGCCTCAGG + Intergenic
1164968790 19:32512187-32512209 CCAGTGGTCTTTATTTCTTCAGG - Intergenic
1165285597 19:34839126-34839148 GCAGGGGACTCTCGAGCTTCGGG + Intergenic
1166036070 19:40169532-40169554 CTCGTGGTCTCACTGGCTTCAGG + Intergenic
925098830 2:1228992-1229014 CTCGTGGTCTCTCTGGCTTCAGG + Intronic
926433012 2:12808943-12808965 CCCGTGGTCTCCATAGATTCAGG + Intergenic
926939683 2:18121771-18121793 CCAGCAGTCTCTCTCACTTCTGG + Intronic
927596801 2:24403871-24403893 CTCCTGGTCTCACTAGCTTCAGG - Intergenic
928493214 2:31804612-31804634 CTCGTGGTCTCGCTGGCTTCAGG - Intergenic
928713628 2:34035307-34035329 CAAGTGTTCTCTCTGGGTTCTGG - Intergenic
928937040 2:36689192-36689214 CTTGTGGTCTCGCTGGCTTCAGG - Intergenic
930247255 2:48997133-48997155 CCAGTGGTCTCTCTAGCTTCTGG + Intronic
931708836 2:64969966-64969988 CTCGTGGTCTCGCTGGCTTCAGG - Intergenic
932486343 2:72086444-72086466 GCAGTGGTCTCACATGCTTCAGG - Intergenic
934898642 2:98139973-98139995 CTTGTGGTCTCGCTGGCTTCAGG - Intronic
937320993 2:120960715-120960737 GTAGAGGCCTCTCTAGCTTCTGG - Intronic
937711706 2:124986844-124986866 CTCGTGGTCTCGCTGGCTTCAGG + Intergenic
938401170 2:130992417-130992439 CTCGTGGTCTCGCTGGCTTCAGG - Intronic
938593310 2:132761387-132761409 CCACTGGTCACCCTAGCTCCAGG + Intronic
938781178 2:134586360-134586382 CCAGCCCTCTCTCTAGCTGCTGG + Intronic
939404658 2:141740916-141740938 CCACTACTCTCTCTAGTTTCTGG + Intronic
939738623 2:145880335-145880357 CTCGTGGTCTCGCTGGCTTCAGG + Intergenic
939777199 2:146402963-146402985 CTCGTGGTCTCGCTGGCTTCAGG + Intergenic
939972409 2:148677837-148677859 CTTGTGGTCTCGCTGGCTTCAGG + Intronic
940666548 2:156617419-156617441 CTCGTGGTCTCGCTGGCTTCAGG + Intergenic
942867411 2:180692150-180692172 CTCGTGGTCTCGCTGGCTTCAGG - Intergenic
943067170 2:183100737-183100759 CCACTGTTCTTTCCAGCTTCTGG + Intergenic
943494609 2:188605875-188605897 CTCGTGGTCTCACTGGCTTCAGG + Intergenic
943511654 2:188834320-188834342 CCCTTGCTCTCTCTTGCTTCTGG + Intergenic
944362103 2:198869313-198869335 CTCGTGGTCTCGCTAACTTCAGG + Intergenic
945762693 2:213934092-213934114 CCATTGTTCTTTGTAGCTTCTGG - Intronic
946982010 2:225228801-225228823 CTCGTGGTCTCGCTGGCTTCAGG + Intergenic
947015662 2:225617062-225617084 CCTTTGGTCTCTCTATTTTCAGG + Intronic
947640086 2:231702319-231702341 GCACTGGCCTCTCTAGTTTCTGG - Intergenic
947868103 2:233415432-233415454 CCATTGCTGTCTCTAGCTGCAGG + Intronic
947937871 2:234023480-234023502 TTCGTGGTCTCGCTAGCTTCAGG + Intergenic
948398069 2:237662110-237662132 CCAGGCGTCTCTCCAGCTTCTGG + Intronic
948550636 2:238770460-238770482 CCAGTGGTCTCTCTGAATTGAGG - Intergenic
1169849337 20:10032651-10032673 CTCGTGGTCTCGCTGGCTTCAGG - Intronic
1170548131 20:17452488-17452510 CCAGTCATCTCTCTTCCTTCTGG + Intronic
1170990040 20:21292849-21292871 CTCGTGGTCTCGCTGGCTTCAGG - Intergenic
1172346501 20:34205419-34205441 CTCGTGGTCTCGCTGGCTTCAGG + Intronic
1173601750 20:44300105-44300127 CTTGTGGTCTCGCTGGCTTCAGG - Intergenic
1173871429 20:46344433-46344455 ACAGTGGTATCTCTAGCATGAGG - Intergenic
1174486354 20:50863818-50863840 CCAGTGGCCTCGCTGGGTTCAGG - Intronic
1174933640 20:54843592-54843614 CCAGTGCGCTCTGTAGCATCTGG + Intergenic
1175210221 20:57349369-57349391 CTCGTGGTCTCGCTGGCTTCAGG - Intergenic
1179477153 21:41654400-41654422 CCAGAGATCACTCTAGCCTCTGG - Intergenic
1180115527 21:45701374-45701396 CCAGTGGGCTCTCAAACTTTTGG + Intronic
1183481795 22:38069277-38069299 CCAGAGGCCTCTCCAGCTCCCGG + Intronic
1183685372 22:39358517-39358539 CTCGTGGTCTCGCTGGCTTCAGG - Intronic
1184283112 22:43450131-43450153 TCAGTGTTCTCTGTGGCTTCTGG + Intronic
1184703023 22:46190044-46190066 ACAGAGGGCTTTCTAGCTTCTGG + Intronic
1184906111 22:47487785-47487807 CTCGTGGTCTCGCTGGCTTCAGG + Intergenic
1185094288 22:48797847-48797869 CCAGGCCTCTCTCCAGCTTCTGG + Intronic
949940255 3:9149249-9149271 CAGATGGGCTCTCTAGCTTCAGG - Intronic
950929559 3:16774810-16774832 CTTGTGGTCTCTGTGGCTTCAGG - Intergenic
951008439 3:17647239-17647261 TCTGTGGTTTATCTAGCTTCTGG - Intronic
951040073 3:17980274-17980296 CCAGTGGTCTCCCTGAGTTCAGG - Intronic
951492307 3:23285027-23285049 CCACTACTCTCCCTAGCTTCTGG + Intronic
952211068 3:31229950-31229972 CCAGTACTCTTTCTAGCCTCTGG - Intergenic
952702188 3:36339306-36339328 CAAGTGGTCTCTCTACATTTGGG + Intergenic
953532366 3:43750014-43750036 CCAGTGTTCTCTCTTTCTGCTGG + Intergenic
953582837 3:44172705-44172727 TTAGTGGTCTCGCTGGCTTCAGG + Intergenic
953907102 3:46873908-46873930 CCAGTGTCCCCTCCAGCTTCAGG + Intronic
954030560 3:47817103-47817125 CAGGTGGTTTCTCAAGCTTCAGG + Intronic
954485860 3:50850901-50850923 GCAGAAGTCTCTCTTGCTTCAGG + Intronic
955266292 3:57448470-57448492 CTCGTGGTCTCGCTGGCTTCAGG + Intronic
955449622 3:59051789-59051811 CTCGTGGTCTCGCTGGCTTCAGG - Intergenic
956481632 3:69678655-69678677 CTCGTGGTCTCGCTGGCTTCAGG - Intergenic
956860524 3:73319258-73319280 CCTGAGGCCTCTCTAGCCTCAGG + Intergenic
957829890 3:85504279-85504301 CTCGTGGTCTCGCTGGCTTCAGG + Intronic
958405908 3:93759785-93759807 GCAGTGGTCCCTGCAGCTTCCGG + Intergenic
959323474 3:104907234-104907256 TTCGTGGTCTCTCTGGCTTCAGG - Intergenic
959422903 3:106149764-106149786 CTCGTGGTCTCGCTGGCTTCAGG - Intergenic
959571846 3:107893233-107893255 CCTGCAGCCTCTCTAGCTTCAGG - Intergenic
959701823 3:109306167-109306189 CCAGAGGTATGTCTAGCTGCTGG - Intronic
960149619 3:114237400-114237422 CTCGTGGTCTCGCTGGCTTCAGG + Intronic
960227402 3:115184435-115184457 CTCGTGGTCTCGCTGGCTTCAGG + Intergenic
960282214 3:115792092-115792114 CTCGTGGTCTCGCTGGCTTCGGG - Intergenic
960810323 3:121621871-121621893 TCAGTAGCCTCTCTAGTTTCTGG - Exonic
961378972 3:126484886-126484908 CAAGAGGCCTCTCTAGCTGCAGG - Intronic
961798647 3:129427773-129427795 CCAGTGGCCTCTCCATCTCCTGG + Intronic
962600351 3:136986973-136986995 CTCGTGGTCTCGCTGGCTTCAGG + Intronic
962671543 3:137713928-137713950 CCCGTGGTCTCTCTGGCTTCAGG + Intergenic
962758411 3:138485820-138485842 CTCGTGGTCTCGCTGGCTTCAGG - Intergenic
963071916 3:141311633-141311655 CCTGTGGTCTCTCTGGCTTCTGG - Intergenic
963314458 3:143744225-143744247 CCAGTTGCATCTCTTGCTTCTGG + Intronic
963440563 3:145334239-145334261 CTCGTGGTCTCACTGGCTTCAGG - Intergenic
963583501 3:147155267-147155289 TTCGTGGTCTCTCTGGCTTCAGG - Intergenic
964064179 3:152560194-152560216 TTTGTGGTCTCTCTGGCTTCAGG - Intergenic
964265228 3:154888470-154888492 TTCGTGGTCTCGCTAGCTTCAGG + Intergenic
964451980 3:156821905-156821927 CTCGTGGTCTCGCTGGCTTCAGG + Intergenic
965109276 3:164401366-164401388 CTCGTGGTCTCGCTGGCTTCAGG + Intergenic
965288199 3:166843812-166843834 CTTGTGGTCTCGCTGGCTTCAGG - Intergenic
967380490 3:188852348-188852370 CATGTGGTCTCTCCAGCTTTGGG + Intronic
968181443 3:196598428-196598450 CTCGTGGTCTCACTGGCTTCAGG + Intergenic
969228271 4:5812929-5812951 CCAGAGGGCTCACTAGGTTCTGG - Exonic
969440888 4:7216102-7216124 CTCGTGGTCTCTCTGGCTTCAGG - Intronic
969654795 4:8490497-8490519 CTGGTGGTCTCGCTGGCTTCAGG + Intronic
969654810 4:8490599-8490621 CTCGTGGTCTCTCTGGCTTCAGG + Intronic
970051409 4:11918767-11918789 CTCGTGGTCTCGCTTGCTTCAGG - Intergenic
970408492 4:15785920-15785942 CTCGTGGTCTCGCTGGCTTCAGG + Intronic
970803662 4:20004778-20004800 CTCGTGGTCTCGCTGGCTTCAGG - Intergenic
971376958 4:26063363-26063385 CTCGTGGTCTCGCTGGCTTCAGG + Intergenic
972392694 4:38627827-38627849 CTCGTGGTCTCACTGGCTTCAGG - Intergenic
973764936 4:54154390-54154412 CTTGTGGTCTCTCTGGCTTCAGG + Intronic
974147565 4:57966396-57966418 CTCGTGGTCTCACTGGCTTCAGG - Intergenic
974188127 4:58466230-58466252 TTAGTGGTCTCGCTGGCTTCAGG - Intergenic
974484636 4:62491294-62491316 CTCGTGGTCTCGCTGGCTTCAGG + Intergenic
974781577 4:66560768-66560790 CTTGTGGTCTCGCTGGCTTCAGG + Intergenic
974804704 4:66863030-66863052 CCAGTGGACCCTGTAGTTTCTGG + Intergenic
976406547 4:84665840-84665862 CTCGTGGTCTCACTGGCTTCAGG - Intergenic
976862268 4:89679726-89679748 TTCGTGGTCTCTCTGGCTTCAGG + Intergenic
977906629 4:102484382-102484404 CTAGTGGTCTTGCTGGCTTCAGG - Intergenic
978514778 4:109558598-109558620 TCAGTGGTTTCGCTGGCTTCAGG - Intergenic
978581549 4:110236576-110236598 CCATTGGTTCCTCCAGCTTCTGG + Intergenic
979899564 4:126200722-126200744 CTCGTGGTCTCGCTGGCTTCAGG + Intergenic
980043233 4:127963626-127963648 CCCGTGGTCTCGCTGGCTTCAGG + Intronic
980230111 4:130037936-130037958 CTTGTGGTCTCGCTGGCTTCAGG + Intergenic
980738070 4:136917107-136917129 CAATTCCTCTCTCTAGCTTCTGG + Intergenic
980799911 4:137734709-137734731 CTTGTGGGCTCTCTAGCTTCAGG - Intergenic
981275961 4:142898472-142898494 CTCGTGGTCTCACTGGCTTCAGG - Intergenic
982701842 4:158665565-158665587 CTCGTGGTCTCACTGGCTTCAGG - Intergenic
982728347 4:158928790-158928812 CTCGTGGTCTCGCTGGCTTCAGG - Intronic
982814428 4:159868420-159868442 CTCGTGGTCTCACTGGCTTCAGG + Intergenic
983026256 4:162740633-162740655 CTCGTGGTCTCACTGGCTTCAGG - Intergenic
983060500 4:163153943-163153965 CTCGTGGTCTCGCTGGCTTCAGG - Intronic
983084719 4:163428728-163428750 CCAGTGGTCTCACTGACTTCAGG - Intergenic
983369611 4:166841981-166842003 TCTGTGGTCTCGCTGGCTTCAGG + Intronic
983752992 4:171299251-171299273 CTGGTGGTCTCGCTGGCTTCAGG - Intergenic
983820288 4:172184423-172184445 CCAGGGGTCTCTATGTCTTCTGG + Intronic
984128304 4:175839950-175839972 ACATTGGTCTCTCTCGCTTCAGG - Intronic
984192673 4:176624447-176624469 CTCGTGGTCTCGCTGGCTTCGGG + Intergenic
984238667 4:177192584-177192606 CTCGTGGTCTCGCTGGCTTCAGG + Intergenic
984241695 4:177227002-177227024 CTCGTGGTCTCGCTGGCTTCAGG + Intergenic
984265816 4:177496563-177496585 CTCGTGGTCTCACTGGCTTCAGG - Intergenic
984775960 4:183482076-183482098 CTCGTGGTCTCACTGGCTTCAGG + Intergenic
984948579 4:184989524-184989546 CTCGTGGTCTCACTGGCTTCAGG + Intergenic
986077964 5:4357511-4357533 ACAGTGCTCTGTCCAGCTTCTGG + Intergenic
986698150 5:10376249-10376271 CTCGTGGTCTCGCTGGCTTCAGG - Intronic
986849413 5:11793620-11793642 CCAGGCCTCTCTCCAGCTTCTGG - Intronic
987476532 5:18399048-18399070 CTCGTGGTCTCGCTGGCTTCAGG + Intergenic
987532632 5:19142186-19142208 CTCGTGGTCTCCCTGGCTTCAGG + Intergenic
988036151 5:25829936-25829958 TTTGTGGTCTCTCTGGCTTCAGG + Intergenic
988086819 5:26484548-26484570 CTCGTGGTCTCACTGGCTTCAGG + Intergenic
988369393 5:30346515-30346537 CTCGTGGTCTCGCTGGCTTCAGG - Intergenic
988488980 5:31691271-31691293 CTCGTGGTCTCGCTGGCTTCAGG + Intronic
988684590 5:33514775-33514797 CTCGTGGTCTCGCTGGCTTCAGG + Intergenic
989268438 5:39504244-39504266 CCATGTCTCTCTCTAGCTTCTGG + Intergenic
989691041 5:44144830-44144852 CCACTGGTCTCTCTAGATAGTGG - Intergenic
990419134 5:55614693-55614715 CTGGTGGTCTCGCTGGCTTCAGG - Intergenic
990597977 5:57330229-57330251 CCAGTGCACTCAATAGCTTCAGG + Intergenic
990691627 5:58370509-58370531 CAAGTGGCCTCTCTTGCATCAGG - Intergenic
991215099 5:64151148-64151170 TTTGTGGTCTCGCTAGCTTCAGG - Intergenic
991567410 5:68019793-68019815 CTCGTGGTCTCGCTGGCTTCAGG + Intergenic
992013081 5:72550036-72550058 CCTATGCTCTGTCTAGCTTCTGG - Intergenic
992947279 5:81822958-81822980 CTCGTGGTCTCACTGGCTTCAGG + Intergenic
993770435 5:91918211-91918233 TCCGTGGTCTCGCTGGCTTCAGG - Intergenic
993844500 5:92923928-92923950 TCAGTTTTCTCTCTGGCTTCTGG - Intergenic
994167149 5:96619646-96619668 TTAGTGGTCTCGCTGGCTTCAGG - Intronic
994254645 5:97579381-97579403 CTGGTGGTCTCGCTGGCTTCAGG + Intergenic
994507246 5:100657608-100657630 CTTGTGGTCTCGCTGGCTTCAGG - Intergenic
995326258 5:110893295-110893317 CTCGTGGTCTCGCTGGCTTCAGG + Intergenic
996435854 5:123431529-123431551 CTCGTGGTCTCTCTGGCTTCAGG - Intergenic
996575746 5:124975439-124975461 CTCGTGGTCTCGCTGGCTTCAGG + Intergenic
997864486 5:137449025-137449047 CCAGTGATCTCCCTACCCTCAGG + Intronic
999855121 5:155586061-155586083 CTCGTGGTCTCGCTGGCTTCAGG + Intergenic
1000066174 5:157694762-157694784 CTCGTGGTCTCGCTGGCTTCAGG - Intergenic
1000246447 5:159452390-159452412 CCAGTGGTCTGCATAGCTCCTGG + Intergenic
1000329037 5:160193285-160193307 CTCGTGGTCTCGCTGGCTTCAGG + Intronic
1001084585 5:168691515-168691537 CCAGTGGCATCTCCAGCCTCTGG - Intronic
1002649418 5:180680686-180680708 CTAGTGGTAACTCCAGCTTCTGG - Intergenic
1002681492 5:180968913-180968935 TTCGTGGTCTCTCTGGCTTCAGG + Intergenic
1004354210 6:14916979-14917001 TTCGTGGTCTCGCTAGCTTCAGG - Intergenic
1004769614 6:18767360-18767382 CCAGTGGTCTCTCTAATGTGGGG + Intergenic
1004865889 6:19853652-19853674 CTTGTGGTCTCGCTGGCTTCAGG + Intergenic
1005707307 6:28468742-28468764 CTCGTGGTCTCACTGGCTTCAGG + Intergenic
1006696153 6:35932245-35932267 CTTGTGGTCTCGCTGGCTTCAGG - Intergenic
1008038952 6:46775690-46775712 CTCGTGGTCTCCCTGGCTTCAGG - Intergenic
1008284173 6:49628775-49628797 CTCGTGGTCTCGCTGGCTTCAGG + Intronic
1008470833 6:51882593-51882615 CCATTGGTCTCTTAGGCTTCAGG - Intronic
1008844992 6:55951668-55951690 TTCGTGGTCTCTCTGGCTTCAGG - Intergenic
1009408074 6:63332974-63332996 CTCGTGGTCTCTCTGGCTTCAGG + Intergenic
1009470414 6:64024669-64024691 TTCGTGGTCTCGCTAGCTTCAGG - Intronic
1009690983 6:67031649-67031671 CTTGTGGTCTCGCTGGCTTCAGG - Intergenic
1009978997 6:70703829-70703851 CCAGTGGCCTCCCTAACTCCAGG - Intronic
1010025640 6:71212966-71212988 CCAGGCCTCTCCCTAGCTTCTGG - Intergenic
1010199162 6:73268301-73268323 CTCGTGGTCTCGCTGGCTTCAGG + Intronic
1010327146 6:74577660-74577682 CCTGTGGTCTCTCTGGCTGCAGG - Intergenic
1011246698 6:85327177-85327199 CTCGTGGTCTCGCTGGCTTCAGG - Intergenic
1011869944 6:91881321-91881343 CTCGTGGTCTCACTGGCTTCAGG + Intergenic
1012851148 6:104447359-104447381 TTAGTGGTCTCGCTGGCTTCAGG - Intergenic
1013143412 6:107363511-107363533 CTCGTGGTCTCGCTGGCTTCAGG + Intronic
1013945324 6:115716099-115716121 TTCGTGGTCTCACTAGCTTCAGG + Intergenic
1014088229 6:117372590-117372612 TTCGTGGTCTCTCTGGCTTCAGG + Intronic
1014218941 6:118780852-118780874 CCCTTGGCCTCTCTAGCCTCGGG + Intergenic
1014507921 6:122281716-122281738 CTTGTGGTCTCGCTGGCTTCAGG - Intergenic
1014788630 6:125645423-125645445 CTCGTGGTCTCTCTGGCTTCAGG - Intergenic
1016067221 6:139697311-139697333 CTCGTGGTCTCGCTGGCTTCAGG + Intergenic
1016127369 6:140421564-140421586 CCACTGCTCTTTTTAGCTTCTGG + Intergenic
1016482151 6:144494376-144494398 CTTGTGGTCTCGCTGGCTTCAGG + Intronic
1016850720 6:148616147-148616169 CCAGAGGTCTCCCAAGCTTAGGG - Intergenic
1017537541 6:155364205-155364227 CTCGTGGTCTCCCTGGCTTCAGG - Intergenic
1017581067 6:155866141-155866163 CTCGTGGTCTCGCTGGCTTCAGG + Intergenic
1017839340 6:158209088-158209110 CTCGTGGTCTCGCTGGCTTCAGG + Intergenic
1019944102 7:4313207-4313229 CTCGTGGTCTCGCTGGCTTCAGG + Intergenic
1019965590 7:4496197-4496219 CTCGTGGTCTCGCTGGCTTCAGG + Intergenic
1020375186 7:7477630-7477652 TTAGTGGTCTCGCTGGCTTCAGG + Intronic
1020519792 7:9171463-9171485 CCAGTGAGTTTTCTAGCTTCAGG + Intergenic
1021593753 7:22293169-22293191 CCAAGTATCTCTCTAGCTTCTGG + Intronic
1021644024 7:22770214-22770236 CCAGTGCTCTCCCAAGCCTCTGG + Intergenic
1024171829 7:46795910-46795932 TCAGTGGTCTCTGGGGCTTCAGG - Intergenic
1024243055 7:47450023-47450045 CCAGAGGTATCTCTAGCCTCTGG + Intronic
1025067426 7:55869456-55869478 CTCGTGGTCTCGCTGGCTTCAGG - Intergenic
1025961914 7:66230586-66230608 CTTGTGGTCTCGCTGGCTTCAGG + Intronic
1026203100 7:68232006-68232028 TTTGTGGTCTCTCTGGCTTCAGG - Intergenic
1027561826 7:79740275-79740297 CTTGTGGTCTCGCTGGCTTCAGG - Intergenic
1027667392 7:81056869-81056891 CTCGTGGTCTCGCTGGCTTCAGG + Intergenic
1027668895 7:81072300-81072322 CACGTGGTCTCCCTGGCTTCAGG - Intergenic
1027698117 7:81436358-81436380 CTCGTGGTCTCGCTGGCTTCAGG + Intergenic
1027868264 7:83674463-83674485 CTCGTGGTCTCGCTGGCTTCAGG - Intergenic
1028070249 7:86441538-86441560 CTCGTGGTCTCGCTGGCTTCAGG - Intergenic
1028511093 7:91626989-91627011 CTCGTGGTCTCGCTGGCTTCAGG + Intergenic
1029672869 7:102046109-102046131 CCACTGGTCTCTTCAGCCTCAGG - Intronic
1030215583 7:107041749-107041771 CTCGTGGTCTCGCTGGCTTCAGG + Intergenic
1030623714 7:111820250-111820272 GCAGTGGTCTCTCTAGTTCCTGG + Intronic
1030780560 7:113594290-113594312 CTCGTGGTCTCGCTGGCTTCAGG - Intergenic
1031378940 7:121060918-121060940 CTCGTGGTCTCGCTGGCTTCAGG - Intronic
1032561462 7:132898073-132898095 CTCGTGGTCTCCCTGGCTTCAGG + Intronic
1033393936 7:140956222-140956244 CTCGTGGTCTCGCTGGCTTCAGG + Intergenic
1034966975 7:155397741-155397763 CTCGTGGTCTCGCTGGCTTCAGG + Intergenic
1035862284 8:3042139-3042161 CCAGGGGTCTCTCATGCATCTGG + Intronic
1039375368 8:37027341-37027363 CCCGGGATCTCTCTAGCATCAGG + Intergenic
1039984949 8:42439293-42439315 CCTGAGGCCTCCCTAGCTTCTGG + Intronic
1040794319 8:51272323-51272345 CTCGTGGTCTCGCTGGCTTCAGG - Intergenic
1041001542 8:53459768-53459790 TTTGTGGTCTCTCTGGCTTCAGG - Intergenic
1041622632 8:59990357-59990379 CTAGTGGTCTCTGTGGCCTCAGG - Intergenic
1041914665 8:63127007-63127029 CTCGTGGTCTCGCTGGCTTCAGG - Intergenic
1042948600 8:74178713-74178735 CTTGTGGTCTCGCTGGCTTCAGG + Intergenic
1043102087 8:76059729-76059751 TTCGTGGTCTCGCTAGCTTCAGG + Intergenic
1044633333 8:94299769-94299791 CTCGTGGTCTCGCTGGCTTCAGG + Intergenic
1044880525 8:96718474-96718496 CTTGTGGTCTCGCTGGCTTCAGG + Intronic
1046284918 8:112082473-112082495 CTCGTGGTCTCTCTCGTTTCAGG + Intergenic
1046352412 8:113032858-113032880 CCATTGGTCTGTGCAGCTTCAGG + Intronic
1046621353 8:116531977-116531999 CTCGTGGTCTCGCTGGCTTCAGG - Intergenic
1046775279 8:118158007-118158029 CCAGTGGTCTCTGTAAGTTGAGG + Intergenic
1048358753 8:133676143-133676165 CCAGTGGTCTCCCTAAGTTTAGG + Intergenic
1049087482 8:140489827-140489849 CTCGTGGTCTCACTAGCTTCAGG + Intergenic
1049332588 8:142063172-142063194 GCAGGGGCCTCTCTAGCTTGTGG - Intergenic
1049500481 8:142960609-142960631 CTCGTGGTCTCGCTGGCTTCAGG - Intergenic
1051383452 9:16481449-16481471 CTCGTGGTCTCGCTGGCTTCAGG - Intronic
1052885316 9:33641164-33641186 GCAGTGGTCTCTCCAGCATAGGG + Intergenic
1053458600 9:38251034-38251056 CCAGTGGTCTCTCTCTCTGATGG - Intergenic
1055049510 9:71964460-71964482 CTTGTGGTCTCGCTGGCTTCAGG - Intronic
1055461323 9:76523169-76523191 CTCGTGGTCTCGCTGGCTTCAGG + Intergenic
1056080793 9:83092526-83092548 CTTGTGGTCTCGCTGGCTTCAGG + Intergenic
1056743901 9:89283394-89283416 CTCGTGGTCTCGCTGGCTTCAGG - Intergenic
1056914179 9:90730384-90730406 TTAGTGGTCTCGCTGGCTTCAGG - Intergenic
1057187223 9:93063567-93063589 CCTGTGGCCTCTCTTGCTGCAGG - Intronic
1057511290 9:95681386-95681408 CTCGTGGTCTCGCTGGCTTCAGG - Intergenic
1058174705 9:101723378-101723400 CTTGTGGTCTCGCTGGCTTCAGG + Intronic
1058235555 9:102486351-102486373 CTTGTGGTCTCTCTGGCTTTAGG + Intergenic
1058286709 9:103187833-103187855 TTCGTGGTCTCCCTAGCTTCAGG - Intergenic
1059791016 9:117642153-117642175 TTAGTGGTCTCGCTGGCTTCAGG + Intergenic
1061247819 9:129410125-129410147 CCAGGCTTCTCTCCAGCTTCTGG - Intergenic
1061925671 9:133805002-133805024 CCTGTGTGCTCTGTAGCTTCAGG - Intronic
1062628816 9:137454555-137454577 CCAGTGCTCTCCCTGGCTCCTGG + Intronic
1062637297 9:137498350-137498372 CCAGTGGTCTCTCTACTTTCCGG - Intronic
1185636393 X:1555020-1555042 CCAGTTGTCTCTCTGGCTGTTGG + Intergenic
1187304030 X:18078856-18078878 CCAGTGTTTTCCCTAGCTTGAGG + Intergenic
1187873560 X:23783901-23783923 CACTTGGTCTCTCTGGCTTCTGG - Intronic
1188189749 X:27158694-27158716 CTTGTGGTCTCGCTGGCTTCAGG - Intergenic
1188923001 X:36002196-36002218 CCAGTGGTCTCCCTTCCTTCTGG - Intergenic
1190045613 X:47109608-47109630 CTTGTGGTCTCGCTGGCTTCAGG + Intergenic
1190726896 X:53195710-53195732 CCAGTGCCCTCTCTTCCTTCAGG + Intronic
1193591660 X:83395897-83395919 CCAGTCTTCTCTCCAGGTTCTGG - Intergenic
1194108263 X:89798640-89798662 CCAGTGCTCTCTTGAGCTGCAGG - Intergenic
1195257868 X:103106535-103106557 CTCGTGGTCTCGCTGGCTTCAGG + Intergenic
1195614473 X:106901690-106901712 CAAGGGGTCTCTCTTGGTTCTGG + Intronic
1196582850 X:117395815-117395837 CTCGTGGTCTCGCTGGCTTCAGG - Intergenic
1196781293 X:119386646-119386668 CTTGTGGTCTCGCTGGCTTCAGG + Intergenic
1196915394 X:120529148-120529170 TCAGTGATCTCTCTGGCTTGAGG + Intronic
1197000121 X:121430797-121430819 CTCGTGGTCTCGCTGGCTTCAGG + Intergenic
1197749437 X:129954536-129954558 CCAGTTGTCTCTGTTGCTTCTGG - Intergenic
1197776155 X:130119946-130119968 GAAGTGGCCACTCTAGCTTCTGG + Intergenic
1197903031 X:131393565-131393587 CCAGTGGCCTCTCAGGCTTAAGG - Intronic
1198775253 X:140172634-140172656 CCCGTGGTCTGTGTAGCCTCAGG + Intergenic
1199441992 X:147878968-147878990 TCCGTGATCTCTCTAACTTCTGG + Intergenic
1200383641 X:155866167-155866189 TTCGTGGTCTCGCTAGCTTCAGG - Intergenic
1200460924 Y:3453376-3453398 CCAGTGCTCTCTTGAGCTGCAGG - Intergenic
1201422914 Y:13819634-13819656 CTCGTGGTCTCACTGGCTTCAGG + Intergenic
1201488302 Y:14513787-14513809 CCGGTGGTCTCGCTGGCTTCAGG - Intergenic