ID: 930247370

View in Genome Browser
Species Human (GRCh38)
Location 2:48998259-48998281
Sequence TGGTATATTAATGAGGAGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 192
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 184}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
930247370 Original CRISPR TGGTATATTAATGAGGAGGA AGG Intronic
901077821 1:6566459-6566481 TGATTTTTTAATGGGGAGGATGG + Intronic
901916172 1:12502331-12502353 TGGAATCTGAGTGAGGAGGAGGG + Intronic
904860236 1:33532485-33532507 TGCTGTAGGAATGAGGAGGAAGG - Intronic
908188484 1:61675864-61675886 TTGTATAGTGATTAGGAGGACGG + Intergenic
908599149 1:65719906-65719928 TGGTGTATTGATGAGCAAGATGG - Intergenic
909123582 1:71636332-71636354 TGGTTTAATAAAGATGAGGAAGG - Intronic
917797877 1:178544732-178544754 TGGAACGTTAATAAGGAGGAAGG + Intronic
918688921 1:187456080-187456102 TTTTATTTTAATGAGGAGAAAGG - Intergenic
918952410 1:191155938-191155960 TAAAAAATTAATGAGGAGGACGG - Intergenic
920842823 1:209569073-209569095 TAGTAAATTGATCAGGAGGATGG + Intergenic
922867874 1:228875943-228875965 AGGAATAATAAGGAGGAGGAGGG - Intergenic
1063830909 10:9951472-9951494 TGGTATTTTAATTAGCATGATGG - Intergenic
1064707497 10:18088192-18088214 TTGTGTATTAATGAGGGTGAAGG + Intergenic
1067216604 10:44309416-44309438 TTTTATATTAAAGAGGGGGAGGG + Intergenic
1067948516 10:50707982-50708004 TGGTAAAGAACTGAGGAGGAGGG + Intergenic
1068518564 10:58053778-58053800 TGGTAGAATAAAGAGGAGAAGGG + Intergenic
1071821001 10:89280749-89280771 TGGAATAATAACGAGGAAGAAGG - Intronic
1072172178 10:92875261-92875283 TGGTAGAGAAAGGAGGAGGAGGG - Intronic
1072524990 10:96263651-96263673 TGGTGAAATAAGGAGGAGGAGGG + Intronic
1074802714 10:117017595-117017617 TAGAAAATTAATGAGGAAGAAGG + Intronic
1075392250 10:122100756-122100778 TGGTATAAAAATGTGGAGAAAGG + Intronic
1077804562 11:5577345-5577367 GGCTATGTTAAAGAGGAGGATGG + Intronic
1079427715 11:20359460-20359482 AGGTAGATAAATGAGGAGAATGG - Intergenic
1081103236 11:39031518-39031540 TGCTGTTTTAATGATGAGGAGGG + Intergenic
1084449604 11:69228223-69228245 TGGAATAATGATGATGAGGATGG + Intergenic
1085709700 11:78817977-78817999 TGGTATTTTAATAAGAGGGAGGG - Intronic
1086251679 11:84823139-84823161 TAGTAAATTGATGAAGAGGAAGG + Intronic
1091707907 12:2712146-2712168 TGGTAAATTAATGGAGAGGGAGG + Intergenic
1091871625 12:3896012-3896034 GGGAATATAAATGAGGGGGAAGG + Intergenic
1092120547 12:6040716-6040738 TGGCATGGGAATGAGGAGGATGG - Intronic
1093146293 12:15570650-15570672 TTGGAAATGAATGAGGAGGATGG + Intronic
1095455212 12:42376444-42376466 AGGTATATTAATGATGATGCAGG + Intronic
1096739443 12:53681653-53681675 TGGTTTTTTAAAAAGGAGGAGGG - Intergenic
1097698634 12:62798689-62798711 TGGCAGGTGAATGAGGAGGAAGG - Intronic
1097946354 12:65373064-65373086 TGGACTAGTAATGAGTAGGATGG + Intronic
1098148344 12:67520561-67520583 TGAAATATTAATGAGGAGACGGG + Intergenic
1099914645 12:88877167-88877189 TGGTAAATTGCAGAGGAGGATGG + Intergenic
1100254326 12:92867031-92867053 TGGAAGATTAATTAGGAAGAGGG - Intronic
1101560905 12:105857167-105857189 TGGTAGATGAATGATGGGGATGG + Intergenic
1101670394 12:106866291-106866313 TGGTATCCTAATGCTGAGGAGGG - Intronic
1102572737 12:113837150-113837172 GTGTATATTAAGTAGGAGGATGG - Intronic
1104270462 12:127278404-127278426 TGGGATATTAGTGGGGAGGTAGG + Intergenic
1106135157 13:26968196-26968218 TGGTCAGTTAGTGAGGAGGAGGG + Intergenic
1106330204 13:28732882-28732904 TAGGATATAGATGAGGAGGAGGG - Intergenic
1106786821 13:33115535-33115557 TGTTTTCTTAATGAGGAAGAAGG - Intronic
1108514525 13:51187690-51187712 TGGTGTATTATTGGGGAGGCAGG + Intergenic
1110127477 13:71964489-71964511 TGGTAAATTAAAGCAGAGGATGG - Intergenic
1110456066 13:75691779-75691801 CAGTATCCTAATGAGGAGGAGGG - Intronic
1110856245 13:80300042-80300064 TGGGTTATTCATAAGGAGGATGG + Intergenic
1111063090 13:83049602-83049624 TGATAATTTAATGAGGAGAATGG + Intergenic
1115403134 14:32986302-32986324 GCGTATTTTAATGAGGAGAAAGG + Intronic
1116412432 14:44640835-44640857 TTGTATGTGAAGGAGGAGGAAGG + Intergenic
1116651416 14:47597670-47597692 TGTTATAATAATTAGGAGAAAGG - Intronic
1117439335 14:55745442-55745464 TGGGGTGTCAATGAGGAGGAAGG + Intergenic
1120249069 14:82040100-82040122 TGGTGTATTGAGGTGGAGGATGG - Intergenic
1120388688 14:83878490-83878512 TGGAATATTAAAGCAGAGGAAGG - Intergenic
1121325367 14:93016624-93016646 TGGCATTTTCAGGAGGAGGAGGG - Intronic
1123388073 15:19839394-19839416 TGGGATACTAATAAGAAGGAAGG + Intergenic
1131664876 15:94559514-94559536 TTGTATACTGATGAGAAGGATGG - Intergenic
1141312260 16:82925774-82925796 TGGTATATTATTGAGGTCAAGGG - Intronic
1144385206 17:14743003-14743025 GGGTATTTTAGTGAGAAGGAAGG + Intergenic
1145908459 17:28529014-28529036 ATGTATATAAATGGGGAGGAGGG + Intronic
1145964463 17:28906988-28907010 TGGTATTCTGAGGAGGAGGAGGG + Exonic
1145970891 17:28955853-28955875 TGGTATATACAGGAGGTGGAGGG + Exonic
1146914987 17:36672755-36672777 TGCCCTAGTAATGAGGAGGAAGG - Intergenic
1151269723 17:72984818-72984840 TGTTAAATGAATAAGGAGGAAGG + Intronic
1152100577 17:78299513-78299535 AGCTCTGTTAATGAGGAGGAGGG - Intergenic
1153471199 18:5447827-5447849 TGGTCTATTTAAGAGAAGGATGG - Intronic
1155111147 18:22715759-22715781 TGGAATATTGAGGAGGATGATGG - Intergenic
1168058370 19:53876443-53876465 TGCTTTCTTAATGAGGAGGGCGG + Intergenic
925815665 2:7745856-7745878 GGGTATTTTAATGAGATGGAAGG - Intergenic
927583507 2:24277597-24277619 TGGTTTAGTGATGAGGAGCATGG + Intronic
927955679 2:27205846-27205868 TGGTATATGAAGGTAGAGGATGG - Intronic
928549862 2:32359438-32359460 TGGTAGATTACTAAAGAGGAGGG + Intronic
929113151 2:38422168-38422190 TGGGCTCCTAATGAGGAGGAGGG - Intergenic
930247370 2:48998259-48998281 TGGTATATTAATGAGGAGGAAGG + Intronic
930412101 2:51037637-51037659 AGCTATATTAAGTAGGAGGAGGG - Intergenic
930799579 2:55429141-55429163 TGAAATATAAGTGAGGAGGATGG - Intergenic
933246073 2:79976052-79976074 TTGTATGTTAATGAGGTGGCTGG - Intronic
936240359 2:110783017-110783039 TGGCTTAATAATGAGGAGCAGGG + Intronic
939358508 2:141136660-141136682 TGGTAAATTAATTAGGAAAAAGG + Intronic
944070946 2:195668395-195668417 TGGTATATTATCCAGGATGAGGG + Intronic
945006038 2:205407674-205407696 TACTAAATTAATGATGAGGAGGG - Intronic
946120524 2:217509035-217509057 TTGTCTATGAATGAGGAGGTAGG + Intronic
1169096765 20:2906576-2906598 AGGTATACTAATGAGAAGAATGG + Intronic
1170326773 20:15164573-15164595 TTGAATATTAATGAGGTGTAAGG + Intronic
1173556215 20:43967685-43967707 TGGTTTATTAATGAGATGGGTGG - Intronic
1175446872 20:59027357-59027379 TGGTATGTTAAGGAGGCAGATGG - Exonic
1176293639 21:5059280-5059302 TGGCAGATGAATGAGGAGGAGGG + Intergenic
1179863621 21:44204368-44204390 TGGCAGATGAATGAGGAGGAGGG - Intergenic
1181993409 22:26855692-26855714 AGTTTTATTAAAGAGGAGGAGGG + Intergenic
1183099707 22:35576364-35576386 TTTTATAATAATGAGGAAGAAGG + Intergenic
1185160528 22:49225575-49225597 TAGTATATTAATAAAGAAGAAGG - Intergenic
950135438 3:10577546-10577568 TGGGAGATTAATGAGGATGATGG - Intronic
951716481 3:25653519-25653541 TGGGGTATTAAGGAGGAGGGTGG - Intronic
952263925 3:31767401-31767423 TAGTGTATTTATGAGGAGGCAGG - Intronic
952693825 3:36242481-36242503 TGGGATAGTAAAGAGCAGGAAGG + Intergenic
953106236 3:39882860-39882882 TGCTATATTAATGCGGAGGGGGG - Intronic
957834845 3:85574050-85574072 AGGTAAAGTGATGAGGAGGAAGG - Intronic
959185457 3:103041196-103041218 TGGTACATTCTTGAGCAGGATGG - Intergenic
961362499 3:126376747-126376769 TGGGATATGAATGGGAAGGATGG - Intergenic
962502688 3:136011026-136011048 TGGTATATTTAGAAAGAGGAGGG - Intronic
963260415 3:143186469-143186491 AGGTATATTGAGGAGGAGGGTGG + Intergenic
963627583 3:147692343-147692365 TGGTGCATTAATGAGGAACAAGG - Intergenic
965516336 3:169625291-169625313 TGGTATATTTTGGAGGAGGTGGG - Intronic
966655534 3:182353555-182353577 TGGCATATTAAAGAGGAATATGG + Intergenic
967092388 3:186146092-186146114 TGAGATATTATTGTGGAGGATGG + Intronic
967420308 3:189265143-189265165 TTGTATATGAATAAGGAGGAAGG + Intronic
967517773 3:190390731-190390753 TGATATATAAATGAGGATGGCGG - Intronic
968846422 4:3044752-3044774 TTGTATGTTAATGAGGTGGCTGG + Intergenic
973154614 4:46935331-46935353 TTATATATTTATTAGGAGGAAGG - Intronic
976087728 4:81423247-81423269 TAGAAAATTAAAGAGGAGGAAGG - Intergenic
977320815 4:95513485-95513507 TTGTCTATTAATGAGGGGAAAGG - Intronic
978295981 4:107205731-107205753 TGGTAGATGAATGAGGTAGAAGG - Intronic
978758747 4:112332217-112332239 TGGTTTATCAATAAGGAGGAAGG + Intronic
978981346 4:114950020-114950042 TGATATATTAATTAGGAACACGG + Intronic
979514300 4:121589279-121589301 TGGTATAGTGATTAGGAGCATGG - Intergenic
980487799 4:133482661-133482683 TAGTATTTTAATGAGAAAGAGGG - Intergenic
980847794 4:138344716-138344738 TGGTTGATCAATGAGGGGGAAGG + Intergenic
981200192 4:141971567-141971589 TGGTATTTTGATGAGAATGATGG - Intergenic
981560250 4:146040571-146040593 TGGTAAATTCATGAGATGGATGG + Intergenic
988082311 5:26429891-26429913 TGCCATATTAATGGGGTGGAAGG + Intergenic
989113898 5:37933142-37933164 TGCTATTTTAATCAGAAGGAGGG - Intergenic
989570443 5:42941602-42941624 TGGGATGTTATTGAGGAGCAGGG - Intergenic
990125438 5:52511188-52511210 TGATATATAAATGAGGGGAAAGG + Intergenic
990178539 5:53134573-53134595 TAGTAGAGTAATGAGGGGGAAGG + Intergenic
990730739 5:58806343-58806365 TGTTATTCTAATGAGGAAGAAGG + Intronic
990995183 5:61726147-61726169 TGATTTATGAATGTGGAGGAAGG + Intronic
992066949 5:73118002-73118024 TTGTATTTTATTGAGGAGAAAGG - Intergenic
995685494 5:114767529-114767551 TGGAGTACAAATGAGGAGGAAGG + Intergenic
997066027 5:130559951-130559973 TTGTAAATAATTGAGGAGGAGGG + Intergenic
998627825 5:143865473-143865495 TGGCAGAAAAATGAGGAGGAAGG + Intergenic
999682581 5:154073878-154073900 GGCTATATTAATGAGGTGTAGGG - Intronic
1000862398 5:166472439-166472461 TGGGAAATTACTGAGGAGAAGGG - Intergenic
1001411354 5:171514709-171514731 TGGTAGATTGAGGAGGACGAGGG + Intergenic
1002662977 5:180803502-180803524 TGGTGTTTTAAAGGGGAGGAAGG + Intronic
1003036292 6:2643168-2643190 TCATGTGTTAATGAGGAGGAGGG + Intergenic
1008025489 6:46631231-46631253 TAGTATAGTAATTAGGAGTAGGG + Intronic
1011304595 6:85912130-85912152 AGGTATAGTAATTAAGAGGATGG - Intergenic
1014575756 6:123070138-123070160 AGCTATATGAATGAGGAGTAAGG - Exonic
1015114084 6:129627593-129627615 TAATAAATTAATGAGGAGGGAGG + Intronic
1015207435 6:130655774-130655796 TGGCATTTTAATGGTGAGGAAGG + Intergenic
1015634605 6:135263315-135263337 TGGTATACAAATGTGGTGGAAGG + Intergenic
1015866746 6:137734735-137734757 TTGTTTAATAATGAGGAAGATGG - Intergenic
1015976777 6:138798639-138798661 TGGTATATTGATGAGGAACTCGG - Intronic
1017736633 6:157370794-157370816 TGGTACATAAATGGGGAGAAGGG + Intergenic
1020930983 7:14393396-14393418 TGGTATACTAATGAGAAAGATGG - Intronic
1025595280 7:62915765-62915787 TGGGATATTAATGAGGCCCAAGG + Intergenic
1026150421 7:67783642-67783664 TGGGACCTGAATGAGGAGGATGG + Intergenic
1027641370 7:80737517-80737539 GGCTATCTTTATGAGGAGGATGG + Intergenic
1028783765 7:94768719-94768741 TGGCATAGTAAGGAGGAAGAGGG - Intergenic
1029959279 7:104672302-104672324 TGGTAGTGTAATGAGGAGAAAGG - Intronic
1033440696 7:141375766-141375788 TGCTGTATTAATTAGGAGGTAGG + Intronic
1034316701 7:150139697-150139719 AGGTATGTTAATGAGGAAGCTGG - Intergenic
1034952254 7:155306765-155306787 TGGTATGCTAATGAGAAGCACGG - Intronic
1035425972 7:158773515-158773537 TGGTATATTACGAAGGATGAAGG - Intronic
1038031185 8:23642227-23642249 TCTTATATTGATGTGGAGGATGG - Intergenic
1038258508 8:25972395-25972417 TGGTATATTTTGGAGGGGGATGG + Intronic
1038264366 8:26026295-26026317 CGGTAAATTATTGAGGAGCAGGG + Intronic
1038710830 8:29943622-29943644 GGGTTTTTTAATGAGGAGCATGG - Intergenic
1039919501 8:41883243-41883265 TGGGGTACTAATGAGGTGGATGG + Intronic
1042172261 8:66003253-66003275 TGATATATTTTTCAGGAGGATGG + Intergenic
1042224295 8:66503639-66503661 TGGGATGTTAATGAGCAGGGAGG - Intronic
1042711766 8:71725396-71725418 TGGGATAATAAGGAAGAGGAAGG + Intergenic
1045130535 8:99147057-99147079 TGTAATTTTAATCAGGAGGAAGG + Intronic
1046245528 8:111555957-111555979 TGTTAAATTACTGAGGATGATGG + Intergenic
1046563983 8:115874876-115874898 TGGTGAACTAATGAGGTGGAAGG + Intergenic
1047915645 8:129581203-129581225 TGGACTATTAAAGAGGAGAAAGG + Intergenic
1048424886 8:134313800-134313822 TGATATGTTAAGGTGGAGGAAGG + Intergenic
1048447374 8:134502121-134502143 TGGTGAAATAATGAGGAGGGGGG - Intronic
1048558914 8:135511391-135511413 AAGAATAATAATGAGGAGGATGG - Intronic
1050816974 9:9827102-9827124 TGGTAGCTTGATGGGGAGGATGG - Intronic
1051472398 9:17460259-17460281 TAGTATAGTAATTAGGAGCATGG - Intronic
1053624189 9:39851944-39851966 TAGTGTATGTATGAGGAGGAGGG + Intergenic
1053880677 9:42591284-42591306 TAGTGTATGTATGAGGAGGAGGG - Intergenic
1053891992 9:42703048-42703070 TAGTGTATGTATGAGGAGGAGGG + Intergenic
1054219708 9:62398754-62398776 TAGTGTATGTATGAGGAGGAGGG - Intergenic
1054231007 9:62510419-62510441 TAGTGTATGTATGAGGAGGAGGG + Intergenic
1056193168 9:84204702-84204724 TGGAAGGGTAATGAGGAGGAGGG + Intergenic
1058874206 9:109228816-109228838 TAGTATTTTAAAGAGTAGGAAGG - Intronic
1058937972 9:109786539-109786561 TGGTATATTGGTGCTGAGGAAGG + Intronic
1059923405 9:119182955-119182977 TGATATATTACTCAGCAGGATGG + Intronic
1061846370 9:133390775-133390797 TGGAATATTCGTGCGGAGGAAGG + Exonic
1195249627 X:103030741-103030763 TGGCACATTAAAGAGGAGTAGGG + Intergenic
1195267543 X:103197796-103197818 TGATTTATTAATGTGTAGGATGG + Intergenic
1196020881 X:110989859-110989881 TGTTATATTCTTTAGGAGGAGGG - Intronic
1196057550 X:111372443-111372465 TGGGATTTTCATTAGGAGGAAGG - Intronic
1198339400 X:135699484-135699506 AGGAATCTGAATGAGGAGGAAGG + Intergenic
1198367874 X:135960415-135960437 TGATGTATGAATGAGGATGATGG + Intergenic
1198526268 X:137504027-137504049 TGGTGGATTGCTGAGGAGGAGGG + Intergenic
1198718135 X:139584469-139584491 TGGGCTATTAAAGAGGAGGTAGG - Intronic
1202131762 Y:21618620-21618642 TGGCATATTAATAAGAAAGAGGG + Intergenic