ID: 930256763

View in Genome Browser
Species Human (GRCh38)
Location 2:49102135-49102157
Sequence GTATAATCCTGGACTATATG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 97
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 86}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
930256763_930256765 -3 Left 930256763 2:49102135-49102157 CCACATATAGTCCAGGATTATAC 0: 1
1: 0
2: 0
3: 10
4: 86
Right 930256765 2:49102155-49102177 TACATACCTTTTTATATTTCTGG 0: 1
1: 0
2: 2
3: 50
4: 530

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
930256763 Original CRISPR GTATAATCCTGGACTATATG TGG (reversed) Intronic
907608627 1:55844959-55844981 CTATAATCTTGAAGTATATGAGG - Intergenic
909160437 1:72141454-72141476 ATATTATCCTGAACTATATTTGG + Intronic
915852933 1:159347275-159347297 GTCTAATCCTGGACTTTTTTTGG - Intergenic
916068520 1:161155989-161156011 GTTGAAACCAGGACTATATGAGG + Intronic
920148088 1:203880282-203880304 TGATAATCTTGGACTGTATGGGG + Intergenic
924265095 1:242273703-242273725 GGATTATCCTGGATTATCTGAGG + Intronic
1063542183 10:6944991-6945013 GTACAATGCTGGTATATATGGGG - Intergenic
1063964599 10:11337377-11337399 GAATAATTCTGGATTATCTGTGG - Intergenic
1064473354 10:15660156-15660178 GTATAATCCGGGAATAATTGTGG - Intronic
1064675819 10:17759313-17759335 GGATAATCCTAGAATATTTGTGG + Intronic
1066719717 10:38324787-38324809 GGATTATCCTGGATTATCTGAGG - Intergenic
1071022394 10:81072917-81072939 GTATGATTCTGGTCTATATGAGG - Intergenic
1071315969 10:84398307-84398329 GTATTATCCTGGATTATCTGAGG - Intronic
1078631036 11:13004668-13004690 GGATAATTCTGGAATAGATGTGG + Intergenic
1083183957 11:61007000-61007022 GTACAATCCTGGGCTAAAAGGGG + Intronic
1085145875 11:74196727-74196749 GTATAATGCTTGTATATATGGGG + Intronic
1086254404 11:84857686-84857708 GTATAATTCTGGATTAGATGGGG - Intronic
1088528151 11:110778832-110778854 GAATAATCTTGGCCTATCTGAGG + Intergenic
1091999457 12:5020406-5020428 GTACAGTCCTGGACTTTCTGAGG + Intergenic
1093199567 12:16170754-16170776 CCATAATCCAGGACTAAATGTGG + Intergenic
1100495318 12:95119536-95119558 GTATAAGGCAGGACTATATGGGG - Intronic
1107824656 13:44317704-44317726 GTATAAGCCTGGGCTCTCTGGGG - Intergenic
1118113388 14:62748228-62748250 GTACAATGCTGGTATATATGGGG + Intronic
1118143947 14:63115842-63115864 GTATTCTCCAGGGCTATATGGGG - Intergenic
1119826305 14:77659942-77659964 GTATAATGATGGACTCTATGGGG - Intergenic
1122868601 14:104622728-104622750 GTACAATGCTGGTATATATGGGG - Intergenic
1126436404 15:48643155-48643177 GAAAAATACTGGACTAAATGAGG + Intronic
1128212584 15:65912982-65913004 CTATAGTCCTGGGCTATGTGAGG - Intronic
1129223091 15:74145616-74145638 GAAGACTCCTGGAATATATGAGG - Intergenic
1139085316 16:63577737-63577759 GTATATTCCTTGACTCTATTGGG - Intergenic
1147465339 17:40606590-40606612 GTACAATGCTTGTCTATATGAGG + Intergenic
1147806369 17:43134776-43134798 GTATGACCCTGAACTGTATGAGG - Intergenic
1148167333 17:45492398-45492420 GTATGACCCTGGACTGTATGAGG + Intergenic
1150398513 17:64838812-64838834 GTATGACCCTGGACTGTATGAGG + Intergenic
1154042715 18:10873365-10873387 GTATAATTCTGTTCTCTATGTGG - Intronic
930256763 2:49102135-49102157 GTATAATCCTGGACTATATGTGG - Intronic
935163336 2:100548216-100548238 ATTTAATGCTGGATTATATGTGG + Intergenic
937109672 2:119354557-119354579 TTATAAACTAGGACTATATGAGG + Intronic
938286741 2:130125202-130125224 CTATAAACAAGGACTATATGAGG + Intronic
938428856 2:131213660-131213682 CTATAAACAAGGACTATATGAGG - Intronic
938469766 2:131547742-131547764 CTATAAACAAGGACTATATGAGG - Intergenic
938881394 2:135593327-135593349 GTATAACCCTGGACTATGGTAGG + Intronic
941636778 2:167943458-167943480 ATATAATGCTGGACTCTATTGGG - Intergenic
942132017 2:172889812-172889834 TTAAACTCCTGGACCATATGTGG + Intronic
944220594 2:197300480-197300502 GTCTAAACCTGCACTATATGTGG + Intronic
945480380 2:210338099-210338121 GTATAAGCCTGGATTATAAATGG + Intergenic
946258999 2:218469582-218469604 GTATAATCCAGGATTGTCTGAGG - Intronic
947178361 2:227390353-227390375 GTACAATACTGGTGTATATGGGG + Intergenic
947645115 2:231733170-231733192 TTAAAATCCTTGTCTATATGGGG + Intronic
1169594221 20:7179718-7179740 GTATAGTCCTGGTCTGGATGTGG - Intergenic
1171301242 20:24062531-24062553 ATATTATCCTGGATTATCTGGGG - Intergenic
949288350 3:2433077-2433099 CTATAATCCAGCACTTTATGTGG - Intronic
950198541 3:11026698-11026720 GCACAATCCTGGACAATTTGGGG + Intronic
950287474 3:11756090-11756112 GTTTATTCCAGGACTATTTGCGG + Intergenic
952639891 3:35580428-35580450 TTATAATCTTGGACAAGATGTGG - Intergenic
956321883 3:68007086-68007108 CTATAATCTTGGTCTGTATGTGG + Intronic
967009252 3:185416411-185416433 GTATAATCATCTACTCTATGAGG + Intronic
971885643 4:32444035-32444057 GAAGATGCCTGGACTATATGAGG - Intergenic
976050220 4:81003152-81003174 GCTTAATCCTGGACTACAAGAGG + Intergenic
981676341 4:147347537-147347559 TTATGATCCAGTACTATATGGGG - Intergenic
981757137 4:148153073-148153095 GTATTAACCTGGACCATAGGAGG - Intronic
981927280 4:150153670-150153692 CTATAATCCTGGACTTTGGGAGG - Intronic
981943223 4:150309295-150309317 GTATACACCTAGGCTATATGGGG - Intronic
983888545 4:173007354-173007376 TCATAATCCAGGACTATATAAGG + Intronic
984791180 4:183616477-183616499 GTATAATCCTGGATTATGGGGGG - Intergenic
985213011 4:187615464-187615486 GGATCATCCTGGATTATCTGGGG + Intergenic
985698500 5:1356732-1356754 GTACAATCCTGGTGTATACGGGG + Intergenic
986451038 5:7865875-7865897 GTAAAAGCATGAACTATATGTGG - Intronic
990737018 5:58875508-58875530 CTATAATCCTGGACAAACTGGGG - Intergenic
991296487 5:65086615-65086637 GTATAATCCATGACTATTTGGGG - Intergenic
992072468 5:73160680-73160702 CTAAAATCTTGGACTATATTTGG + Intergenic
995639053 5:114232475-114232497 TTATAAGCCTGGAGTACATGTGG - Intergenic
997466865 5:134094043-134094065 GTGTGATCCTGGACTCCATGAGG + Intergenic
1002824268 6:758884-758906 ATATAATCCAGAAATATATGTGG - Intergenic
1003410876 6:5862035-5862057 AGATAATCCTGGATTATCTGGGG + Intergenic
1006348189 6:33500409-33500431 GTCTAATCCTGCACTGTTTGTGG + Intergenic
1009983001 6:70747689-70747711 GTTTATTCCTGGACTTTAAGTGG + Intronic
1012280079 6:97317643-97317665 GTATTATCCTGGCTTAGATGGGG - Intergenic
1014475128 6:121862656-121862678 GTCTGGTCCTGGACTATATTTGG + Intergenic
1014742065 6:125157248-125157270 GTGTCTTCCTGGACAATATGAGG - Intronic
1017750557 6:157487198-157487220 GTATCATCCTGGAGGACATGGGG + Intronic
1035095883 7:156355065-156355087 ATAAAATCCTGGACATTATGTGG + Intergenic
1035152911 7:156890049-156890071 GTTTAATTTTGGACTTTATGTGG - Intronic
1036043118 8:5108518-5108540 GTAGAATCCTTCACAATATGGGG - Intergenic
1036166115 8:6435298-6435320 GCATGATCTTGGACTCTATGTGG - Intronic
1036667034 8:10753053-10753075 GTATAATTCTCGCCTATCTGTGG - Intronic
1038969415 8:32615802-32615824 GTATGATCCTGGAGTCTAAGAGG + Intronic
1039334849 8:36577536-36577558 GTTTTATCTTGGAATATATGAGG - Intergenic
1040393403 8:46970288-46970310 GTATTCTCCTGGAATAAATGTGG - Intergenic
1044183843 8:89228234-89228256 ATATAATCCTACACTATATCTGG + Intergenic
1046523440 8:115354938-115354960 GTATTATGGTGGATTATATGTGG + Intergenic
1048788135 8:138073735-138073757 ATATCATCCTGGACTGAATGGGG + Intergenic
1051648228 9:19292284-19292306 GTATAATCCAGGACTTTGGGAGG - Intronic
1058853720 9:109038954-109038976 ATAAAAACCTGGACTCTATGGGG + Intronic
1188414935 X:29921316-29921338 GTTTAATCCTAGACTCTTTGAGG + Intronic
1188458176 X:30391187-30391209 GTATAACCCTCCCCTATATGTGG - Intergenic
1197616830 X:128701536-128701558 GTAAAATCCTGAAGTAGATGAGG + Intergenic