ID: 930257809

View in Genome Browser
Species Human (GRCh38)
Location 2:49111726-49111748
Sequence GAGTTTTCACAGAAGGCTCT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 235
Summary {0: 1, 1: 0, 2: 1, 3: 19, 4: 214}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
930257804_930257809 6 Left 930257804 2:49111697-49111719 CCCACGGCTCCTCAGCAAGTGTC 0: 1
1: 0
2: 0
3: 5
4: 84
Right 930257809 2:49111726-49111748 GAGTTTTCACAGAAGGCTCTGGG 0: 1
1: 0
2: 1
3: 19
4: 214
930257805_930257809 5 Left 930257805 2:49111698-49111720 CCACGGCTCCTCAGCAAGTGTCT 0: 1
1: 0
2: 0
3: 16
4: 145
Right 930257809 2:49111726-49111748 GAGTTTTCACAGAAGGCTCTGGG 0: 1
1: 0
2: 1
3: 19
4: 214
930257806_930257809 -3 Left 930257806 2:49111706-49111728 CCTCAGCAAGTGTCTATTATGAG 0: 1
1: 0
2: 1
3: 12
4: 119
Right 930257809 2:49111726-49111748 GAGTTTTCACAGAAGGCTCTGGG 0: 1
1: 0
2: 1
3: 19
4: 214
930257803_930257809 7 Left 930257803 2:49111696-49111718 CCCCACGGCTCCTCAGCAAGTGT 0: 1
1: 0
2: 0
3: 5
4: 97
Right 930257809 2:49111726-49111748 GAGTTTTCACAGAAGGCTCTGGG 0: 1
1: 0
2: 1
3: 19
4: 214

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
930257809 Original CRISPR GAGTTTTCACAGAAGGCTCT GGG Intronic
900962375 1:5933360-5933382 GAGTTATCACAGAAGTCACCTGG + Intronic
904810815 1:33162415-33162437 GACTGTTGACAAAAGGCTCTGGG - Intronic
904833038 1:33317636-33317658 GCTTTTTCAGAGAAGGCTATGGG - Intronic
905684690 1:39900516-39900538 GGCTTTGCACAAAAGGCTCTCGG + Intronic
905887760 1:41500836-41500858 GATTCTTCACAGAAGCCACTGGG - Intergenic
909671654 1:78195948-78195970 GTGTTCTCTCTGAAGGCTCTAGG + Intergenic
909818298 1:80025351-80025373 TAGTTTTCTCATAAGGCACTGGG - Intergenic
909864935 1:80655493-80655515 GAGTTGTCACACAAAACTCTGGG + Intergenic
913138409 1:115915272-115915294 GAGTTTCCACAGTGGGCTGTTGG - Intergenic
913144406 1:115976056-115976078 CACTTTTCTCTGAAGGCTCTAGG + Intergenic
918164778 1:181934677-181934699 GAGATTTCTCACAAGGCCCTGGG - Intergenic
919882158 1:201907841-201907863 CAGTGTTGACAGAAGCCTCTTGG - Intronic
921663335 1:217835184-217835206 GAGTTTTCCAAGAAATCTCTTGG + Intronic
922771958 1:228190221-228190243 GAGATTTCTCAGAAGGGTCAGGG - Intergenic
923224522 1:231926931-231926953 TATTTTTCTCAGAAGGCTATTGG + Intronic
923644423 1:235802265-235802287 GAGTCTTGCCAGAAGTCTCTTGG + Intronic
924009990 1:239654267-239654289 GAGTTTCCAAAGAAGCTTCTTGG - Intronic
1063380765 10:5584112-5584134 GTGTTTTCACTGAAGCCGCTGGG - Intergenic
1064241450 10:13633270-13633292 GAGTTCTCACTGAGCGCTCTGGG - Intronic
1067109188 10:43387376-43387398 GAGTTAGCTGAGAAGGCTCTAGG - Exonic
1067264291 10:44723880-44723902 GTGTTCTCACAGAAAGCCCTGGG + Intergenic
1067775602 10:49162898-49162920 GGGTTTTCACACAGGGCTCTTGG - Intronic
1068138509 10:52974919-52974941 GAATTTTGAGGGAAGGCTCTGGG + Intergenic
1070512421 10:77173717-77173739 CAGTTTACTTAGAAGGCTCTGGG + Intronic
1072224221 10:93353096-93353118 GTGTTTTCATAGAAGGCCCAGGG + Intronic
1072362699 10:94675262-94675284 GAATTATCTCAGCAGGCTCTGGG - Intergenic
1072766504 10:98098840-98098862 AAGTATTCACAGAATGTTCTTGG - Intergenic
1073844022 10:107531853-107531875 GAGTTATCACTAAAAGCTCTTGG - Intergenic
1078838488 11:15055073-15055095 TAGTCATTACAGAAGGCTCTTGG - Intronic
1081590651 11:44420748-44420770 AAGAAATCACAGAAGGCTCTGGG - Intergenic
1082085154 11:48044047-48044069 CAGCTTACTCAGAAGGCTCTGGG + Intronic
1082630779 11:55539464-55539486 GCTTTTTCACAGAAGGATCTAGG - Intergenic
1083156293 11:60825293-60825315 GAGTTCTCTCTGAAGGCTCTTGG + Intergenic
1083232455 11:61332117-61332139 GTGTTTTCATATAAAGCTCTGGG - Intronic
1083366750 11:62145882-62145904 GAGGTTTCCCAGAAGTCTCCAGG + Intronic
1083792262 11:64993671-64993693 GAGTTCTCACAGTATGGTCTTGG + Intronic
1084536985 11:69763033-69763055 GAGTGGCCAGAGAAGGCTCTGGG + Intergenic
1088545692 11:110956519-110956541 GAATTTTGACAGAAGAGTCTAGG - Intergenic
1089474358 11:118746350-118746372 GAGTTTTTATAGAAGGCACAAGG + Intergenic
1090023613 11:123149234-123149256 GTGTTTCCTCTGAAGGCTCTAGG - Intronic
1090123985 11:124066488-124066510 GAGTTTTTACAGAAGACAATAGG - Intergenic
1097969618 12:65619060-65619082 GAAATTTAACAGGAGGCTCTGGG + Intergenic
1099082601 12:78204375-78204397 GAGTTTTTACAGAAAGCAATGGG + Intronic
1099284330 12:80697450-80697472 GGGTTGACACAGAAGGCTTTAGG - Intergenic
1099432864 12:82608902-82608924 GAGCTGTCACAGAATGCTCTGGG + Intergenic
1099551529 12:84050866-84050888 GTGTTTCCACAGATGTCTCTTGG - Intergenic
1100020009 12:90057687-90057709 GAATTATTAGAGAAGGCTCTTGG + Intergenic
1100885441 12:99064935-99064957 GATGTTTAACAAAAGGCTCTAGG - Intronic
1102286706 12:111663558-111663580 GAGATGTCAGAGAAGGCTTTGGG - Intronic
1102784757 12:115595410-115595432 GTGTTCTCTCTGAAGGCTCTAGG - Intergenic
1104571911 12:129933436-129933458 GGGCTTCCACAGAAGGATCTGGG + Intergenic
1104800817 12:131554341-131554363 ATGTTTTCACAGAGGCCTCTTGG - Intergenic
1105558227 13:21465807-21465829 GAGTGTTTACAGAAGGCTGGAGG - Intergenic
1105748654 13:23400868-23400890 GAGTTTTCCCATAAGGCCCTTGG + Intronic
1106558312 13:30828679-30828701 GAGATTTTAAACAAGGCTCTAGG + Intergenic
1106785834 13:33107416-33107438 GATTATGCACAGAGGGCTCTGGG + Intronic
1106873290 13:34044697-34044719 GTGTTCTCTCTGAAGGCTCTAGG - Intergenic
1107680865 13:42848665-42848687 GAGATTTCCCAGCATGCTCTAGG + Intergenic
1110232955 13:73185635-73185657 GAGTACTTACAGAAGGCTCTAGG + Intergenic
1110361626 13:74631838-74631860 GAATTCTCACAGAGGGCTCCAGG - Intergenic
1112790802 13:103000556-103000578 GAGTTATCACAAATGGCTCCAGG + Intergenic
1112983268 13:105413731-105413753 GAGCTTCCACACAAGGCTGTTGG - Intergenic
1114543213 14:23479062-23479084 GAGTTTTTAAAAAAGGCTTTGGG + Intronic
1114788118 14:25624560-25624582 GACTTCCCACAAAAGGCTCTAGG - Intergenic
1116242881 14:42368840-42368862 GAGTTTTCAGAAAAGGGTCAAGG - Intergenic
1116351634 14:43871138-43871160 GAGTAGTTACAGCAGGCTCTGGG - Intergenic
1118449335 14:65884831-65884853 GAGATTTCCCAGAAAGCTCCGGG - Intergenic
1118730254 14:68660996-68661018 GACTTTCCCCTGAAGGCTCTAGG - Intronic
1119805654 14:77480419-77480441 GGGGTTTCACAGAAAGCACTGGG - Intronic
1120057835 14:79946414-79946436 GAGGGGTCACAGTAGGCTCTGGG - Intergenic
1120208146 14:81608277-81608299 GTGCTCTCTCAGAAGGCTCTAGG + Intergenic
1124072980 15:26413069-26413091 AAGTTTTCACAGGAGGATCTGGG + Intergenic
1127303430 15:57679826-57679848 GAGTGTGCCCAGAAGGCTGTGGG - Intronic
1127387476 15:58478093-58478115 GAGTTATCAGAGATGGCTTTAGG - Intronic
1128552222 15:68605688-68605710 GAGGAGTCACAGAGGGCTCTTGG + Intronic
1129116107 15:73366316-73366338 GAGTTTGCAAAGAGGGCTCTGGG + Intronic
1130509853 15:84580603-84580625 CAGTTTCCACGGAATGCTCTGGG - Intergenic
1132403333 15:101527249-101527271 AAGTTTTCACAGATGAGTCTAGG + Intergenic
1133552440 16:6870111-6870133 GATTTTTTGCATAAGGCTCTTGG + Intronic
1136346681 16:29680360-29680382 GGCTTTACACAGAATGCTCTGGG - Intronic
1142291904 16:89197102-89197124 CACTGCTCACAGAAGGCTCTGGG - Intronic
1142744391 17:1948436-1948458 GAGGTTTCAGTGAAGGCTCTGGG + Intronic
1144708821 17:17387278-17387300 GAGTGGTCAGAGAAGGCGCTGGG - Intergenic
1145471147 17:23540107-23540129 AAGCTTTCACAGAAAACTCTTGG + Intergenic
1145508972 17:24090621-24090643 AAGCTTTCACAGAAAACTCTTGG + Intergenic
1145510489 17:24112497-24112519 AAGCTTTCACAGAAAACTCTTGG + Intergenic
1145523161 17:24296598-24296620 AAGTATTCACAGAAAACTCTTGG + Intergenic
1145531927 17:24424342-24424364 AAGCTTTCACAGAAAACTCTTGG + Intergenic
1145576440 17:25071763-25071785 AAGCTTTCACAGAAAACTCTTGG + Intergenic
1145678622 17:26557635-26557657 GAGCATTCACAGAAAACTCTTGG + Intergenic
1150463705 17:65373728-65373750 AGCTTTTCACAGAAGGCACTGGG - Intergenic
1151958219 17:77391236-77391258 GAGTGGCCACAGCAGGCTCTAGG + Intronic
1153374605 18:4361484-4361506 CAGTTTTCACTGAATGGTCTTGG - Intronic
1153634984 18:7105834-7105856 TATTTTTCAAAGAAGGGTCTTGG + Intronic
1157134879 18:45044494-45044516 GAGGTTTTTCAGAAGGCTTTTGG - Intronic
1158022292 18:52857621-52857643 GATTATTCACAGAAGTCACTGGG - Intronic
1158377535 18:56888105-56888127 GGGTTTTCACAGAATGCTTCAGG - Intronic
1159754458 18:72347554-72347576 GGCTAGTCACAGAAGGCTCTGGG + Intergenic
1159916186 18:74189774-74189796 GAATTTGCAAAGGAGGCTCTTGG - Intergenic
1161164723 19:2780231-2780253 GAGTGTTCACAGAAGGTAGTGGG - Intronic
1162008057 19:7792537-7792559 GGCTTTACACAGAATGCTCTGGG - Intergenic
1162009189 19:7801440-7801462 GGCTTTACACAGAATGCTCTGGG - Intergenic
1162154023 19:8664540-8664562 GAGTTCCCACAGAAGCGTCTCGG + Intergenic
1164471869 19:28543071-28543093 GAGGTTTCACTGATGCCTCTGGG + Intergenic
1164947606 19:32309707-32309729 GATTTTGCAGAGAAGGCCCTCGG - Intergenic
1165731882 19:38151196-38151218 GAGATTTCCCAGAAGCCTCTGGG + Intronic
1166015987 19:39979843-39979865 GAGTTTGTACAGAAGTATCTGGG + Exonic
1167924282 19:52810633-52810655 TGGTTTTAACAGCAGGCTCTGGG + Intronic
925044699 2:763965-763987 GGGTTTTCCCAGAAGGACCTTGG + Intergenic
925534528 2:4901965-4901987 GAGTGTCCACAAAAGCCTCTAGG - Intergenic
926521664 2:13923229-13923251 GAGTTTTAACACATGGCTTTTGG - Intergenic
927406819 2:22780140-22780162 GAGATGCCACAGTAGGCTCTTGG + Intergenic
927587684 2:24323201-24323223 GAGTATTAACAAAAGACTCTTGG + Intronic
928945192 2:36765761-36765783 GAGCTTTCTCAGGAGGCTATAGG - Intronic
930241330 2:48938385-48938407 GAGTATGCACACAGGGCTCTGGG + Intergenic
930257809 2:49111726-49111748 GAGTTTTCACAGAAGGCTCTGGG + Intronic
930551218 2:52837070-52837092 GTGTTTTTCCTGAAGGCTCTAGG + Intergenic
930806725 2:55497844-55497866 CAGTTTTCACAGAAGTTCCTGGG + Intergenic
932842599 2:75097580-75097602 GAGTCATCACAGAAGACTGTGGG + Intronic
933949081 2:87313056-87313078 GAGTTTTCACTTAAGGATTTAGG - Intergenic
934983911 2:98870194-98870216 GAGTGTTGACAGAGGGCTCTGGG + Intronic
935163166 2:100546900-100546922 TAGTTCTCACAGCAGGCTGTGGG + Intergenic
935576402 2:104716200-104716222 GAGTGGTTACAGCAGGCTCTGGG + Intergenic
936331116 2:111548541-111548563 GAGTTTTCACTTAAGGATTTAGG + Intergenic
937205079 2:120231169-120231191 GTGTTTTCACAGATGCCTTTAGG + Intergenic
937816090 2:126252092-126252114 GAGGCTTCACAGCTGGCTCTTGG + Intergenic
938595965 2:132787388-132787410 GAGCTTCAAGAGAAGGCTCTGGG + Intronic
938624402 2:133092406-133092428 GAGTTCCTTCAGAAGGCTCTAGG - Intronic
944215417 2:197249795-197249817 TAGTTTTCAAAGAAGCGTCTAGG + Intronic
944484075 2:200185081-200185103 GTGTTTTCAGAGAATGCCCTGGG - Intergenic
944720083 2:202415032-202415054 CAGTTTTCACAGAAGACTGAGGG - Intronic
945474074 2:210261389-210261411 AAATTTTCGCAGAAGGCTCCTGG - Intergenic
946093135 2:217248467-217248489 GCTTTTTCCCAGAAGGCTCCAGG + Intergenic
946776828 2:223151550-223151572 GAATATTCACAGAAAGTTCTAGG - Intronic
947990459 2:234483667-234483689 AAGTCCTCACAGAAGGCACTGGG - Intergenic
948658518 2:239491909-239491931 GAGGCTTCTCAGAAGGCCCTAGG - Intergenic
1172835197 20:37869016-37869038 GAGCTTTGGCAGAAGGCTCTGGG - Intronic
1174046728 20:47739089-47739111 GTGCTTCCTCAGAAGGCTCTAGG - Intronic
1174401009 20:50275959-50275981 GAGTTGTCCCAGAGGCCTCTAGG + Intergenic
1175370762 20:58488910-58488932 GGGGTTTCACAGAAGCATCTTGG - Intronic
1175724516 20:61308718-61308740 CAGTTTTGACAGAAGGCCTTGGG - Intronic
1176003757 20:62848036-62848058 GAGTTCTCACAGAAGGATCACGG + Intronic
1176924446 21:14730664-14730686 GAGGTTTCCCAGAGGGCTCCTGG - Intergenic
1179626249 21:42651119-42651141 GGGTTTTCACAGGATCCTCTTGG - Intergenic
1180964887 22:19782913-19782935 GGCTGGTCACAGAAGGCTCTGGG + Intronic
1182139563 22:27941713-27941735 GAGTTTGCACCAAAGGCTTTTGG + Intergenic
950544395 3:13630014-13630036 GAAGGGTCACAGAAGGCTCTGGG - Intronic
950576838 3:13837168-13837190 AAGTGTTCACAGAAGGGTTTTGG - Intronic
952904646 3:38131763-38131785 GAGTGTTCAGAAAAGGCTTTGGG + Intronic
953717353 3:45326808-45326830 GGGGCTTCAGAGAAGGCTCTAGG + Intergenic
956003534 3:64754180-64754202 GAGTTTTACCTGGAGGCTCTGGG + Intergenic
956225620 3:66954444-66954466 GAGATTTCACAGCAGGCTCCTGG + Intergenic
958734906 3:97997199-97997221 GAGTCATCACTGAAGGCTTTCGG + Intronic
959208740 3:103347478-103347500 TAGTTTTCACACAAGGTGCTTGG + Intergenic
959637186 3:108589068-108589090 GAGCGCTCACTGAAGGCTCTAGG - Intronic
960698386 3:120417357-120417379 GAGTTTGCAGAGCAGCCTCTGGG - Intronic
961835133 3:129651676-129651698 GAGTTTGCCCAGAAGGTTCCGGG + Exonic
964236893 3:154541912-154541934 GAGTTTTCACATAAGGGTCTAGG + Intergenic
970602049 4:17648208-17648230 GCGTTGTCACAGAATGCCCTGGG - Intronic
977007561 4:91590022-91590044 CAGTTTTCCCAGAAGCCACTAGG - Intronic
977768246 4:100826388-100826410 ATGTTTTCTCAGAAGGCTCATGG + Intronic
977988693 4:103415900-103415922 GGCTTTACACAGAATGCTCTGGG + Intergenic
978067071 4:104418264-104418286 GAGTTATGACAGATGGCACTAGG - Intergenic
979597544 4:122550923-122550945 AAGTTTTCACAGAGGGCAATAGG + Intergenic
980079937 4:128333611-128333633 GAGATTTCACAGAATGTTGTTGG + Intergenic
980641795 4:135589578-135589600 GAGTGTTTACAGTAGACTCTAGG + Intergenic
980718103 4:136654623-136654645 CAGTCTTTACAGAAGGCACTGGG - Intergenic
981879777 4:149595581-149595603 GCTATTTCACAGAAGGCGCTAGG - Intergenic
983357429 4:166681528-166681550 AAGTTTTCCCAGAAGGTTTTAGG + Intergenic
986544347 5:8879587-8879609 GAGTGGTCACAGCAGGCCCTGGG - Intergenic
986707001 5:10460635-10460657 CTGTTCACACAGAAGGCTCTGGG - Intronic
988582381 5:32479401-32479423 GAGATTTCACAGAATGCCCCAGG - Intergenic
988932389 5:36049030-36049052 AACATTTCACAGAAGGCTCTAGG - Exonic
989534612 5:42549626-42549648 GAATCTTCTCAGAAGGTTCTGGG - Intronic
991082642 5:62617889-62617911 CAGTTTATACAGAAGGCTGTGGG - Intronic
995552660 5:113295914-113295936 GCTTTTTCACAGAAGGCTTCAGG - Intronic
995673805 5:114639243-114639265 GTGTTCTCTCTGAAGGCTCTAGG - Intergenic
997622215 5:135306360-135306382 GAGTTTTAACAAAAGTTTCTGGG + Intronic
997836122 5:137194746-137194768 GAGTGCTCACTGAATGCTCTGGG - Intronic
999441423 5:151604105-151604127 GAGTTTTCACACAAAAATCTGGG + Intergenic
1000568279 5:162879779-162879801 GAGTTTACACAGATGTCTCATGG - Intergenic
1000896911 5:166866535-166866557 TGGTTTTGACAGAAGACTCTTGG - Intergenic
1002281731 5:178134231-178134253 GAGATTTCACTGAGGGCTCAAGG + Intronic
1005627824 6:27680155-27680177 GCGTTTGTACAGAAGGCTCCTGG + Intergenic
1006142860 6:31941280-31941302 GTGCTTCCTCAGAAGGCTCTTGG + Intronic
1007087476 6:39159163-39159185 GTGTTATCACTGAAGCCTCTAGG - Intergenic
1007381422 6:41492627-41492649 TTGGTTTCACAGAAGGCACTTGG + Intergenic
1008056292 6:46949341-46949363 AAGTATTAACAGAAAGCTCTGGG + Intronic
1010456394 6:76060903-76060925 TATTTTTCACAGTAGTCTCTAGG - Intronic
1013160448 6:107538731-107538753 GGGTGTTCTCAGAAAGCTCTGGG + Intronic
1017174304 6:151488412-151488434 GAGGATTCAAAGAAGGCTCGTGG + Intergenic
1018202726 6:161410489-161410511 CAGGTTTCACAGCAAGCTCTTGG + Intronic
1022790584 7:33684933-33684955 CACTCTTCACAGAAGGATCTAGG - Intergenic
1023224717 7:37957451-37957473 GTGTTTTCGCAGAAGGATGTTGG + Intronic
1023843212 7:44108002-44108024 GAGGCTTCACAGGAGGCTCTGGG - Exonic
1027929170 7:84508826-84508848 AAGTTTTCAGAGAAGGATTTTGG + Intergenic
1028929940 7:96401768-96401790 GACCTTTCACATAAGCCTCTGGG - Intergenic
1030623223 7:111815301-111815323 GAGTTACCATAGAAAGCTCTGGG - Intronic
1030995357 7:116352819-116352841 GAGTCTACACAGAAGGATGTGGG + Intronic
1032001027 7:128265413-128265435 GAGGTTTCCCAGAGAGCTCTGGG - Intergenic
1033525178 7:142206019-142206041 GACTTTTCACAGATGATTCTGGG - Intronic
1033882382 7:145902006-145902028 GAGTCATTACAGCAGGCTCTAGG - Intergenic
1036982230 8:13483043-13483065 TGCTTTTCTCAGAAGGCTCTAGG + Intronic
1038472756 8:27839058-27839080 GAGTTTTACAAGAAGGCCCTGGG + Intergenic
1038646517 8:29366357-29366379 GAGGAATCACAGATGGCTCTGGG - Intergenic
1041229195 8:55731804-55731826 GAGTTTTCACAGAAAGGGGTGGG + Intronic
1041396860 8:57400598-57400620 GTGGTTTCAAAGGAGGCTCTTGG - Intergenic
1041676266 8:60543265-60543287 GTGTTCTCTCAGAAGGCTCCAGG + Intronic
1044140082 8:88639669-88639691 TAGTTCTCAGAGAAAGCTCTTGG - Intergenic
1045323772 8:101101624-101101646 GCGTTTTCTCTGGAGGCTCTGGG + Intergenic
1047537010 8:125729197-125729219 GGTGTTTCACAGAAGGCTGTAGG - Intergenic
1047825256 8:128566191-128566213 TACTTTTCAGAGAAGGATCTGGG + Intergenic
1048367611 8:133752295-133752317 CAGTTTTCACATATGGCTCTGGG - Intergenic
1048405623 8:134117324-134117346 CACTTTTCACAGAAGTCTATTGG - Intergenic
1050098584 9:2094162-2094184 GAGTTGTTTGAGAAGGCTCTGGG + Intronic
1050100024 9:2109263-2109285 GAATTTTGAAAGAAGGCTTTAGG - Intronic
1050169968 9:2805060-2805082 GAGTTTACATAGCATGCTCTTGG - Intronic
1050638487 9:7639687-7639709 GAGTGTTGACAGAGAGCTCTGGG + Intergenic
1050914041 9:11108593-11108615 GAGTTTTTACAGCAGGCCTTAGG + Intergenic
1051978358 9:22982370-22982392 GAGTTTTGACAGATGGATCTCGG - Intergenic
1056699149 9:88887739-88887761 GAGTTTTTAGAGAAGCCTCTGGG - Intergenic
1058332560 9:103781670-103781692 GGTTTTTATCAGAAGGCTCTGGG + Intergenic
1058759917 9:108120633-108120655 GAGTTCCCACAGCAGGCTTTTGG - Intergenic
1059665488 9:116442587-116442609 GTGACTTCACAGAAGGCCCTGGG + Intronic
1062666998 9:137679506-137679528 CTGTTCTCACAGAAGGCGCTGGG + Intronic
1186893633 X:13984802-13984824 TAGTTTTGCCAGAAAGCTCTGGG + Intergenic
1187654357 X:21453359-21453381 GAGTTTAAACAGAAGGATGTGGG + Intronic
1189722152 X:43931084-43931106 GAGTTGTCAGAGAATGCCCTGGG - Intergenic
1190984062 X:55484827-55484849 GAGTCTTCCCTGAATGCTCTAGG - Exonic
1193218822 X:78898647-78898669 GAGCTTTCACAGATGGGCCTTGG - Intergenic
1195229436 X:102831326-102831348 GAGTTTTCACATAACACTTTAGG - Intergenic
1197859213 X:130951230-130951252 GAGACTTCAAAGAAGGTTCTCGG - Intergenic
1198698102 X:139365324-139365346 CAATTCTCACAGAAGGCTCGGGG + Intergenic
1200001996 X:153066929-153066951 CAAGATTCACAGAAGGCTCTGGG - Intergenic
1200005736 X:153083096-153083118 CAAGATTCACAGAAGGCTCTGGG + Intergenic