ID: 930258656

View in Genome Browser
Species Human (GRCh38)
Location 2:49119964-49119986
Sequence TGACGGCTCTTTAAAGTGGG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 77
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 71}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
930258656 Original CRISPR TGACGGCTCTTTAAAGTGGG AGG Intronic
903791767 1:25898109-25898131 TGAAGGCTTTTGAATGTGGGGGG - Intronic
903970383 1:27115028-27115050 TGCCCCATCTTTAAAGTGGGTGG - Intronic
904318895 1:29683787-29683809 TGGTGGCTCTTTAAGGTGGAGGG + Intergenic
907255597 1:53176291-53176313 TGAAGGCTCTTTGCAGAGGGAGG + Intergenic
1065819071 10:29508612-29508634 TGAAGTCACTTTAAAGTGCGAGG - Intronic
1065953748 10:30675310-30675332 TGAAGTCACTTTAAAGTGCGAGG + Intergenic
1070682819 10:78461126-78461148 TGACTGCTCTTTGTAGCGGGTGG + Intergenic
1071756084 10:88541840-88541862 TGAGGGTTCTTTATAGTGGAGGG + Intronic
1073027015 10:100495418-100495440 TGATGTCTCTTTAGAGTGGAGGG + Exonic
1074256111 10:111804071-111804093 TGAAGGGTCTCTAAGGTGGGTGG + Intergenic
1075959756 10:126558305-126558327 TGAAGGATTTTTAAAGTGGAGGG - Intronic
1082893227 11:58162730-58162752 TGACATCTCTGTAAAGTTGGTGG + Intronic
1091699687 12:2651465-2651487 TGTCCACTCATTAAAGTGGGCGG + Intronic
1093422976 12:18996170-18996192 TGATGCCTCTGGAAAGTGGGTGG + Intergenic
1099293839 12:80805399-80805421 TGGGGGGTCTTTAGAGTGGGAGG + Intronic
1100908415 12:99329923-99329945 TGAATGCACTTTAAAGAGGGTGG - Intronic
1101633211 12:106515841-106515863 TGACAGATCTTTGGAGTGGGGGG + Intronic
1107634838 13:42381731-42381753 TTACAGCTCTTAAAAGTGGCAGG - Intergenic
1115057701 14:29151140-29151162 TTACAGCTCTTTAAGGTGGCGGG - Intergenic
1121644665 14:95509558-95509580 TTCCTGCTCTTTAAAGAGGGAGG - Intergenic
1122333389 14:100945345-100945367 AGACAGCTCTTTAATGAGGGAGG + Intergenic
1124206200 15:27723225-27723247 TTCCTGCTCTTTGAAGTGGGGGG - Intergenic
1139179061 16:64724449-64724471 TGAAGGCTTTTGAAAGTGGTAGG + Intergenic
1140617564 16:76684576-76684598 TTATGGCTCTTTAAAGTTGGAGG + Intergenic
1141427683 16:83954312-83954334 TGACGTTTCTTTCAAGTGTGCGG - Intronic
1143460785 17:7102118-7102140 TGATGGCTCTTGGAAATGGGTGG - Exonic
1144298230 17:13899518-13899540 TGACAGCTCTATAAAGGAGGTGG - Intergenic
1146306287 17:31732286-31732308 TCACAGCTCTTAAAAGTGGCAGG - Intergenic
1149093120 17:52807975-52807997 TGACAGTTTTTTAAATTGGGTGG - Intergenic
1152131432 17:78479235-78479257 GCACAGCTCTTTGAAGTGGGAGG + Intronic
1155408943 18:25520546-25520568 TGAGGGTTCATTAAAGAGGGAGG + Intergenic
1155926505 18:31661051-31661073 AGACGGCTCTGCAAATTGGGGGG + Intronic
1158537822 18:58323675-58323697 TGAGGTCGCTTCAAAGTGGGTGG + Intronic
1161523389 19:4738481-4738503 TGACAGCTCTTTAGGGTGGTGGG - Intergenic
930258656 2:49119964-49119986 TGACGGCTCTTTAAAGTGGGAGG + Intronic
932247837 2:70211389-70211411 TGAAGGCTGTTTAAAGAGGTAGG + Exonic
936290282 2:111217495-111217517 TGCCTGCTCCATAAAGTGGGAGG + Intergenic
939771518 2:146325862-146325884 TGTTGGCTCCTCAAAGTGGGAGG - Intergenic
941749179 2:169117400-169117422 TGATGGCTGTTTTAAGTGGAAGG + Intergenic
944284210 2:197930221-197930243 AAACGTCTATTTAAAGTGGGAGG - Intronic
944818560 2:203405211-203405233 TGATAACTGTTTAAAGTGGGTGG + Intronic
1175149576 20:56922805-56922827 TGACATCTCTTCAAAGTGCGAGG + Intergenic
1180625521 22:17191093-17191115 TGGCTGCTCTTTAAAGTGAGGGG + Intronic
1180711695 22:17843547-17843569 TGACGGCTCTGGGAGGTGGGTGG - Intronic
953270216 3:41435171-41435193 TTACTTCTCTGTAAAGTGGGTGG + Intronic
953863419 3:46564310-46564332 GGATGGCTCTGTAAAGTGGATGG - Intronic
957164471 3:76654180-76654202 TGACGGCTTTCTAAAGTGAGAGG - Intronic
960582616 3:119294075-119294097 AGCCGGCTCTTTGAAGTGGCGGG - Intergenic
976860246 4:89656547-89656569 TGAGGGCTCTTTAACCTGGGTGG + Intergenic
977347503 4:95835907-95835929 TGACGGATGTTTAAAGAGAGAGG - Intergenic
977886758 4:102260423-102260445 AAAAGGCTCTTTAAAGAGGGAGG + Intronic
978928168 4:114275836-114275858 TTATGGCTCTGTAAAGTGGAGGG - Intergenic
981788855 4:148512488-148512510 TGAGGCCTCTGTAAAGTGGCAGG + Intergenic
987329649 5:16845313-16845335 GGACAGCTCTTTAAAATGGAAGG - Intronic
993330028 5:86587861-86587883 TGACAGCTCAGTAAAGTGTGAGG - Intergenic
996273411 5:121636458-121636480 TGACTGCTCTTACAAGTTGGAGG + Intergenic
1000426107 5:161093369-161093391 TGCCTGCTCTTTGGAGTGGGAGG - Intergenic
1015762355 6:136677941-136677963 TGACAACTCTTTAAAGTAGGGGG + Intronic
1017420592 6:154268297-154268319 TGTCTGCTCTTTGGAGTGGGAGG + Intronic
1019296169 7:276545-276567 TGCCTGCTCTGTAGAGTGGGAGG - Intergenic
1023615545 7:42016041-42016063 TGCCAGTTCTTTATAGTGGGAGG - Intronic
1028679610 7:93510568-93510590 TGAGGGGTCTCTAAAGAGGGTGG + Intronic
1034887162 7:154806771-154806793 TGAAAGCTCTTGAGAGTGGGAGG + Intronic
1035634437 8:1133270-1133292 TGCAGGCTCCTGAAAGTGGGGGG + Intergenic
1037245194 8:16826479-16826501 TGACTACTCTTTTATGTGGGAGG - Intergenic
1039840649 8:41290663-41290685 CGAGGGCTCCTTCAAGTGGGTGG + Intronic
1050268004 9:3911327-3911349 TGATGGCTCTTTATCCTGGGAGG + Intronic
1053090275 9:35269124-35269146 TGATTGGTCTCTAAAGTGGGAGG - Intronic
1055481736 9:76715264-76715286 TGATGGCTTTTTGAAGTGGCTGG - Intronic
1056832325 9:89927344-89927366 TGACGGGTGATTAAAGTGTGGGG - Intergenic
1187433108 X:19242677-19242699 TGAAGCATCTTTACAGTGGGTGG + Intergenic
1189645122 X:43119950-43119972 TGAAGTCTCTTTTAAATGGGAGG + Intergenic
1190247830 X:48702202-48702224 TGAGGGCTCCTGACAGTGGGCGG + Intronic
1193972898 X:88078753-88078775 TAATGGCTCTTTAAATTGTGAGG + Intergenic
1194066597 X:89269274-89269296 TTACAGCTCTTAAAAGTGGCTGG + Intergenic
1197003639 X:121469954-121469976 TGACTGCTCTTTAAAGCAGTGGG - Intergenic
1200720767 Y:6603428-6603450 TTACCGCTCTTAAAAGTGGCTGG + Intergenic