ID: 930260688

View in Genome Browser
Species Human (GRCh38)
Location 2:49142679-49142701
Sequence CTGTTAATTCAAGTGAAACA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 208
Summary {0: 1, 1: 0, 2: 1, 3: 10, 4: 196}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
930260687_930260688 3 Left 930260687 2:49142653-49142675 CCTCTAGCTGCTGCATAGGGGAT 0: 1
1: 0
2: 0
3: 7
4: 88
Right 930260688 2:49142679-49142701 CTGTTAATTCAAGTGAAACAAGG 0: 1
1: 0
2: 1
3: 10
4: 196

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
930260688 Original CRISPR CTGTTAATTCAAGTGAAACA AGG Intronic
908948135 1:69524761-69524783 CAGCTGATTCAAGGGAAACAGGG - Intergenic
909013596 1:70360243-70360265 CAATAAATTCAATTGAAACAGGG + Intronic
909501490 1:76339819-76339841 TTATGAATTCAAGTGAAGCAGGG + Intronic
909621250 1:77670139-77670161 AGTTTAATTCAAGTAAAACATGG - Intronic
910600572 1:89027500-89027522 CTGTTCTTGCAAGTGTAACATGG + Intergenic
912723155 1:112036985-112037007 CTGTTAATTCAATGGTAATAAGG + Intergenic
914807699 1:151003580-151003602 CTTTTAATTAAACTGAGACAGGG + Intronic
915683607 1:157607326-157607348 CAGGTTATTCAAGTGAAAAAGGG + Intergenic
916282319 1:163065458-163065480 CAGTGACTTTAAGTGAAACAAGG - Intergenic
918120065 1:181530464-181530486 CAGTTGATTCCAGTGAAAAATGG + Intronic
918762372 1:188428323-188428345 CTGTTATTTAAAATGAATCAGGG - Intergenic
919377505 1:196813141-196813163 CTGTTAATTCAACTAAAAATTGG + Intergenic
919387019 1:196935039-196935061 CTGTTAATTCAACTAAAAATTGG + Intronic
920334422 1:205235065-205235087 CTGATCATTCTAGTCAAACAGGG - Intronic
922687635 1:227657167-227657189 CTGTTAGTTCATGTGAAAGCTGG + Exonic
923960483 1:239077076-239077098 CTATTAATTCAATTTAAAAATGG + Intergenic
1063078564 10:2741906-2741928 CCGTTATTTTAAGTGAAACAAGG - Intergenic
1063617766 10:7616524-7616546 CTTTTAATTAAAATGGAACATGG + Intronic
1063618901 10:7626750-7626772 CTCTGAATTCAAATGAAACTGGG + Intronic
1064867002 10:19892009-19892031 CTTTTCATTAAAGTAAAACAAGG + Intronic
1065873893 10:29980587-29980609 CTGTGACTTTAAGTGAAACGAGG - Intergenic
1065965966 10:30770359-30770381 CTGTTTATTCAAAAGAGACAGGG + Intergenic
1071125626 10:82331735-82331757 CTGTTTATTAAAGTGGACCATGG + Intronic
1072687086 10:97543947-97543969 CTGTTAAGTTAGTTGAAACAAGG + Intronic
1073117635 10:101100633-101100655 CTGGGAATGGAAGTGAAACAGGG - Intronic
1073582305 10:104679891-104679913 TTTTTAATTAAACTGAAACATGG + Intronic
1073999260 10:109352301-109352323 CTGTGAATTCATCTGAAACACGG + Intergenic
1074237989 10:111605502-111605524 CTGTGAGTTCAAGTCAAAGATGG + Intergenic
1075727708 10:124618997-124619019 CTTCTAACTCAAGTGACACAAGG + Intronic
1077949941 11:6945586-6945608 CTGAGAATTCAAGTGAGATAAGG - Intronic
1080909668 11:36582981-36583003 CAGTTATTTCAAGTGTAACATGG - Intronic
1081012162 11:37827000-37827022 CTGTTCTTTCTAGTGAAAAAAGG - Intergenic
1085024711 11:73229682-73229704 CTCTTAATTCAAGGGAGACAGGG + Intronic
1087164456 11:94987166-94987188 CTGTGAATGCAAATGGAACAAGG + Intronic
1088081623 11:105923329-105923351 CTCTAAAATCAAGTGAAATAAGG - Intronic
1088234726 11:107710319-107710341 CTGTTAAGTCATGGGAATCATGG + Intronic
1090685485 11:129113276-129113298 TTGTGAATTCAAGTGTTACAAGG - Intronic
1090955153 11:131506841-131506863 CTTTTAATTCCAGGGGAACAGGG + Intronic
1093840191 12:23888879-23888901 AGGCTAATTCAATTGAAACAAGG - Intronic
1093982790 12:25493485-25493507 TTGTGAATTTAATTGAAACAAGG - Intronic
1095302011 12:40595994-40596016 CTGATAATTCAATTTAAAAATGG + Intergenic
1098188086 12:67919825-67919847 CCATTAATTCAAGTGACAGAAGG + Intergenic
1099706473 12:86159638-86159660 CTGTAAATTCACCTGAACCAGGG + Intronic
1100176751 12:92039315-92039337 CAGGTTATTAAAGTGAAACAAGG + Intronic
1103966232 12:124641628-124641650 CTGTTATTTCTAGGGTAACATGG - Intergenic
1107579042 13:41762398-41762420 CAGGTAATTCTAGTGAAACGAGG + Intronic
1107579045 13:41762430-41762452 CAGGTAATTCTAGTGAAACCAGG + Intronic
1107824286 13:44313482-44313504 CTGTAAAATCAAATAAAACATGG + Intergenic
1108082857 13:46755319-46755341 CTGTTTATCAAAGTGATACATGG + Intergenic
1108123634 13:47216787-47216809 CTGTTAATTCAGGGGCAATATGG + Intergenic
1108778514 13:53797590-53797612 GTGATAACTCAAGTTAAACATGG + Intergenic
1109705973 13:66092952-66092974 CTGTTTATCCAACTGAAGCAGGG - Intergenic
1109776469 13:67047686-67047708 CTATCATTCCAAGTGAAACAAGG + Intronic
1112369634 13:98783688-98783710 CTGTGAAGTCAAGAGAAACAGGG + Intergenic
1113682184 13:112252279-112252301 CTGTTAACTCAAGTGGAGCCTGG + Intergenic
1114334601 14:21675278-21675300 CTGTTAAAACAAATGAAATATGG + Intergenic
1115794142 14:36913629-36913651 CTGTTAATTGGAGTAAAACAAGG + Intronic
1116237965 14:42305775-42305797 TTATTAATTCTAGTGAAAAAGGG - Intergenic
1116997985 14:51343866-51343888 TTGTTAGTTCAAGTGAAGGAAGG + Intergenic
1118004893 14:61556618-61556640 CTGTTAATCCAAGGGGAGCAGGG - Intronic
1119979911 14:79068580-79068602 ATGTTAATTCAAGTGACAAGTGG - Intronic
1120102321 14:80459593-80459615 CTGTTAAGTTCAATGAAACATGG - Intergenic
1120775187 14:88426849-88426871 CTGATAGTTCTAGTGATACATGG - Intronic
1122331219 14:100915606-100915628 CTGGTAAAGGAAGTGAAACAGGG - Intergenic
1126417114 15:48429168-48429190 GTGTTATTTCAAGTGAAGGAGGG + Intronic
1127165401 15:56240490-56240512 CTGTTTATTAAACTGAAATATGG - Intronic
1127551350 15:60041845-60041867 CTTTTAATTAAACTGCAACACGG - Intronic
1128757378 15:70192486-70192508 ATGATAATTCGAGTAAAACACGG - Intergenic
1130740536 15:86594956-86594978 CTGATGGATCAAGTGAAACAAGG - Intronic
1134467544 16:14492656-14492678 CTGTAAAGTGAAGTGACACATGG - Intronic
1137658226 16:50179852-50179874 CTGTTAAATCAAATAAAACCAGG + Intronic
1137910905 16:52377158-52377180 CTTGTAATTCAATTGTAACACGG - Intergenic
1137989509 16:53139420-53139442 ATGTTAATTTAATTGAACCAAGG + Intronic
1145046204 17:19618776-19618798 CTGTTAATTCAAGATGAAGATGG - Intergenic
1146570140 17:33945387-33945409 CTGTTAACTCAGATGGAACAAGG + Intronic
1150180316 17:63112346-63112368 CTGTTAATCCAAGGGAATCTAGG + Intronic
1151000625 17:70371099-70371121 CTGTTTATTCAATTGGAAAATGG - Intergenic
1156559986 18:38113557-38113579 CTGTTATTCTAAGTGAAAGAAGG + Intergenic
1156842158 18:41621987-41622009 GTGTGAATTCCAGTTAAACAAGG + Intergenic
1157016088 18:43715710-43715732 CTATTAATTAAGGTGAATCATGG - Intergenic
1163974091 19:20832047-20832069 CTATTAATTCAAATGAAAACTGG - Intronic
1165995033 19:39837984-39838006 CAGTTTATTCATGTGAAAAATGG - Intronic
1166632364 19:44418373-44418395 AAATTAATTCAACTGAAACAGGG - Intronic
1167969680 19:53180595-53180617 CAGTTAAATTAAGTGAAATAAGG + Intronic
926771015 2:16375285-16375307 CAGTCAATTCAGTTGAAACAAGG - Intergenic
927119117 2:19938035-19938057 CTATTATTTCTAGAGAAACATGG + Intronic
927376973 2:22429042-22429064 ATATTATTTCAAGTGAATCAAGG - Intergenic
927635941 2:24816855-24816877 CAGTTTATTTGAGTGAAACAGGG + Intronic
930260688 2:49142679-49142701 CTGTTAATTCAAGTGAAACAAGG + Intronic
930689705 2:54348084-54348106 CTGTGATTTCCAGTTAAACATGG - Intronic
931123714 2:59250186-59250208 CTGGTATTTCAAGAAAAACAAGG - Intergenic
931559195 2:63539272-63539294 TTTTTACTTCAAGTGAAAAAGGG - Intronic
933885454 2:86715838-86715860 CTGTTAATAAAAATGAATCAGGG - Intronic
933910018 2:86930951-86930973 CAGTTTATTCAAGTAAAATAAGG + Intronic
934022707 2:87972437-87972459 CAGTTTATTCAAGTAAAATAAGG - Intergenic
934849230 2:97686716-97686738 CTTTTAAATCAACTGAAACAGGG - Intergenic
936413569 2:112282662-112282684 CAGTTTATTCAAGTAAAATAAGG + Intronic
937542164 2:122969742-122969764 CTATTTTCTCAAGTGAAACATGG + Intergenic
938222227 2:129580282-129580304 CTGGTAATTCATATGAAACCTGG - Intergenic
941780283 2:169437075-169437097 CTATTAATCCAATTAAAACATGG + Intergenic
942426379 2:175864752-175864774 ATTTTAAGACAAGTGAAACAAGG - Intergenic
942428139 2:175880798-175880820 CGTTTAATCCAAGTGAAACGGGG + Intergenic
942509090 2:176676857-176676879 CTGTTACATAAAGTAAAACATGG + Intergenic
942719817 2:178939047-178939069 CTGCTAATTCAAGTGAGAAGAGG + Intronic
945500472 2:210566713-210566735 CAGTTAGTTCAAGTGTAAAATGG + Intronic
947406715 2:229785895-229785917 CTGTTTATTAAAGTGTAATATGG - Intronic
1169851293 20:10054259-10054281 CTTCTAATTAAAGTTAAACAAGG + Intronic
1172578598 20:36029013-36029035 CTTTCAGTTCAAGTGAGACAGGG + Intronic
1174929792 20:54800601-54800623 ATGTTAAAACAAGTGATACAGGG + Intergenic
1174950428 20:55036021-55036043 CTGTTTATTCCAGTGAGCCAGGG - Intergenic
1176692491 21:9932889-9932911 CTGTTAAATCAAATTAAATATGG - Intergenic
1176943548 21:14952702-14952724 ATGTTAATTTAAGGGAAACCAGG + Intergenic
1177384451 21:20390865-20390887 ATGTTAATTGAAGTTAATCATGG + Intergenic
1178293927 21:31392768-31392790 CTGTTAGTTCAAGTGAGAGTGGG + Intronic
1183015965 22:34986997-34987019 CTGTTATTTCATTTGAAATAAGG + Intergenic
1184830023 22:46979331-46979353 CTGTCACTTCAAAAGAAACAAGG - Intronic
1185252557 22:49812616-49812638 CTGTTAATTTCACTTAAACATGG - Intronic
949977439 3:9473868-9473890 TTGTTAATTCATGTGGAACTTGG - Intronic
950815814 3:15700892-15700914 CTGTTTATTCATTTGATACATGG + Intronic
955132285 3:56182591-56182613 CTGTTTCTTCAAGTGAAAAATGG - Intronic
955473108 3:59307139-59307161 GTGTTAATTTAAGTTAAAGAAGG - Intergenic
955476188 3:59338719-59338741 CTGTTACTTCATGTGCAAAATGG - Intergenic
955511537 3:59685674-59685696 GGGTTATTTAAAGTGAAACATGG + Intergenic
956043405 3:65170246-65170268 CAGTTATTTCAAGTGATATATGG - Intergenic
956942176 3:74175917-74175939 CTGTAAGTTCAAGTGAAAAGAGG - Intergenic
960551839 3:118984612-118984634 ATGTAAATTCAAATGAAAGAGGG + Intronic
963687172 3:148450981-148451003 CTGTTAATTCATGTGAGAGCTGG + Intergenic
965362416 3:167757594-167757616 CTGTATATTCAAATGAACCAGGG + Intronic
969687628 4:8684779-8684801 CCGTTTGTTCAAGTGAAAAATGG + Intergenic
970801577 4:19978682-19978704 CTGTTAACTCAAGGGAGACAAGG + Intergenic
971001260 4:22325261-22325283 CTGTTTATACAAGTGTAAAATGG + Intergenic
972996583 4:44886364-44886386 CTGTTTATTCAAATGTATCAAGG - Intergenic
974391446 4:61275148-61275170 CTGTTCATACAACTGGAACAAGG + Intronic
976113109 4:81698337-81698359 CTGTTAAAACAAGTCCAACAAGG - Intronic
978406476 4:108384742-108384764 CTGTTAAGTGAAGTAAACCATGG + Intergenic
979699382 4:123650475-123650497 TTGAGAATTCAAGTGAAACTTGG + Intergenic
979828338 4:125268433-125268455 CTGCTACTTCCAGTGAAAAAAGG + Intergenic
980261470 4:130454926-130454948 AGGTTTATTCAAGGGAAACACGG + Intergenic
980365079 4:131793110-131793132 CTGTTAAATCAAATTAAATATGG - Intergenic
980688224 4:136257969-136257991 CTGTTAGTTCATGTGAGACCTGG + Intergenic
980853750 4:138414326-138414348 CTGTTAGTCCAACTGAAACCAGG + Intergenic
981765817 4:148248470-148248492 CAGTTAATTAAAGGGAAAAAAGG + Intronic
981874515 4:149524989-149525011 CTTTAAAGTCAATTGAAACAGGG + Intergenic
984998894 4:185465588-185465610 CTTTTCCTTCAAGTGAAACGGGG + Intronic
985012194 4:185594441-185594463 ATGTTAATTCAAATGTAGCATGG - Intronic
986648199 5:9939060-9939082 CTGTTAGTTCATGTGAGACCCGG - Intergenic
987029840 5:13965684-13965706 CTGTTAATTCAGGAGGAACTGGG - Intergenic
987291704 5:16514442-16514464 CTGAAGATACAAGTGAAACAAGG - Intronic
988408144 5:30850776-30850798 CGAATAATTAAAGTGAAACATGG - Intergenic
988439634 5:31218348-31218370 TAGTTAATTAAAGTAAAACATGG + Intronic
989375698 5:40757525-40757547 CTGTAACTTCAAGAAAAACAAGG + Intergenic
993726360 5:91371711-91371733 CTGTTAATTTTTGTGAAATAGGG - Intronic
994126696 5:96175354-96175376 TTTTTAATGCATGTGAAACAAGG - Intergenic
995405698 5:111793100-111793122 CTGTAAATTCAAATGAAACATGG + Intronic
1000891031 5:166802711-166802733 CTATTAATTGAACTGAAATAAGG - Intergenic
1001000713 5:168004366-168004388 CTCTTAATCCCAGTGGAACAGGG + Intronic
1001855458 5:175006547-175006569 CTGCTAATTAATGTGTAACATGG - Intergenic
1007960999 6:45959145-45959167 TTGTAAATTCAAGTGGAAAATGG + Intronic
1009383392 6:63060699-63060721 CAGTTAAATCAATGGAAACAAGG - Intergenic
1010694263 6:78950211-78950233 CTGTTTATTCCAGAGATACAAGG - Intronic
1010859858 6:80897396-80897418 CTGATAGTTCAAGTGAGATAAGG + Intergenic
1010947198 6:81989581-81989603 CTGTTTAATGAAGTAAAACATGG - Intergenic
1011468620 6:87685564-87685586 CTGATAATACAAGTGAAGCTTGG - Intronic
1011738973 6:90340392-90340414 CTGTTAGTTCAAGTGAAAGCTGG + Intergenic
1013921444 6:115409349-115409371 CTGTGAATTCAAGAGCAAGATGG + Intergenic
1014871477 6:126601763-126601785 CTGATAATGCAGGTGAAAGAAGG - Intergenic
1015806189 6:137111284-137111306 CTGTTAATGGAAGTGTAAAACGG + Intergenic
1018364540 6:163104866-163104888 TTGATATTTCAAGTTAAACACGG + Intronic
1020668099 7:11072905-11072927 CTGTTAGTTCACATGAAAGATGG - Intronic
1022326056 7:29333007-29333029 ATGTTCATTCAAAGGAAACATGG + Intronic
1022984705 7:35640345-35640367 CTGTTACTTCAACTGTAAAATGG + Intronic
1026068135 7:67093648-67093670 ATCTTAACTCAAGTAAAACAAGG - Intronic
1026708784 7:72718659-72718681 ATCTTAACTCAAGTAAAACAAGG + Intronic
1027815391 7:82962558-82962580 TTATTAATTTAAGAGAAACAGGG - Intronic
1033805967 7:144954540-144954562 CTCTGAATTCATGTGAGACATGG - Intergenic
1037668385 8:20993248-20993270 CTGTTAATACAATAAAAACATGG + Intergenic
1039222413 8:35348023-35348045 TTGTTTTGTCAAGTGAAACAAGG + Intronic
1040056979 8:43067484-43067506 CTGAGAATTCCAGTTAAACAGGG - Intronic
1041611051 8:59850093-59850115 CAATTAATTCAACTAAAACATGG - Intergenic
1041714207 8:60919428-60919450 CTTTAGCTTCAAGTGAAACAGGG + Intergenic
1043659599 8:82721335-82721357 ATGTTAATATAAATGAAACATGG + Intergenic
1044501078 8:92958276-92958298 CTATGAATTCAAGTTAGACAAGG - Intronic
1045209004 8:100075297-100075319 CTGTTAGTTCAGGTGAGACCTGG + Intronic
1045610380 8:103834226-103834248 CTGTCATCTCAAGGGAAACAGGG - Intronic
1046893452 8:119448297-119448319 TTATTAATTCAAGTAAAGCATGG - Intergenic
1048392175 8:133978143-133978165 CTGATAATTAATGGGAAACAAGG + Intergenic
1048637537 8:136313914-136313936 ATGTTAATTAAAGGGAAAGAAGG + Intergenic
1052703876 9:31970784-31970806 CTTTTACTTAAAGTGGAACAGGG + Intergenic
1053629437 9:39918961-39918983 CTGTTAAATCAAATTAAATATGG - Intergenic
1053776331 9:41544589-41544611 CTGTTAAATCAAATTAAATATGG + Intergenic
1054214450 9:62331741-62331763 CTGTTAAATCAAATTAAATATGG + Intergenic
1054365403 9:64333898-64333920 CTGTTAAATCAAATTAAATATGG - Intergenic
1054924503 9:70576036-70576058 CTGGTAATACAAATGAGACATGG - Intronic
1056294593 9:85179751-85179773 ATTTTAATTTTAGTGAAACAAGG + Intergenic
1057005588 9:91555622-91555644 CTGTCAAGTCAAGAAAAACATGG + Intergenic
1058430239 9:104912063-104912085 ATGTGTATTCAAGTGAAAGAAGG - Intronic
1058778756 9:108312051-108312073 CTGATAAGTCAAGTGAGAGAGGG + Intergenic
1061188444 9:129068615-129068637 CTGTTAAATCAAGTTAAAAGAGG + Intronic
1061731905 9:132621860-132621882 CTCTGAATTCAAGTTAAACTTGG + Intronic
1186813868 X:13216579-13216601 CTGTGAAATCAAATCAAACATGG - Intergenic
1187668855 X:21648163-21648185 ATTTTAATTAAAATGAAACATGG - Intronic
1188010808 X:25053928-25053950 CTGTTATTTCAACTGTAAAAGGG + Intergenic
1188622957 X:32248791-32248813 CTGATAATTCTAGAAAAACAAGG - Intronic
1188894351 X:35648417-35648439 ATGTTGATTGAAGTGCAACAGGG - Intergenic
1191801981 X:65091860-65091882 TTATTAATTCAAATAAAACAGGG + Intergenic
1196406156 X:115364929-115364951 CTGTCAAGTCAAGTGGAAGAGGG - Intergenic
1198652826 X:138882570-138882592 CTGTTACATCAAGGGAAGCATGG + Intronic
1199519960 X:148724098-148724120 CTGTCAATTAACCTGAAACATGG + Intronic