ID: 930261430

View in Genome Browser
Species Human (GRCh38)
Location 2:49151246-49151268
Sequence TCTGCCATCCAGGAGCTGCA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 367
Summary {0: 1, 1: 0, 2: 3, 3: 52, 4: 311}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
930261430 Original CRISPR TCTGCCATCCAGGAGCTGCA GGG Intronic
900464497 1:2818451-2818473 CCTGCCCTGCAGGGGCTGCAGGG + Intergenic
900539873 1:3197289-3197311 GCTGACATCTGGGAGCTGCAGGG - Intronic
900574671 1:3377188-3377210 TCTGACAGCCAGGAGCTGGCGGG - Intronic
900673582 1:3870427-3870449 TCTGCCTGGCAGGAGCAGCAAGG - Intronic
900764428 1:4494513-4494535 CCCCCCATCCAGGGGCTGCAGGG - Intergenic
902713008 1:18253434-18253456 TCAGCCTTGCAGAAGCTGCATGG + Intronic
903139483 1:21330589-21330611 TGTGCCTTCCAGGAGCTCCCAGG - Intronic
903290735 1:22312633-22312655 TTTTCTATCCAGGAGCTGCCTGG + Intergenic
903299695 1:22369977-22369999 TCTGCCATCCAGTAAGTGCGAGG + Intergenic
904251004 1:29224277-29224299 CCAGCCAGACAGGAGCTGCATGG - Intronic
904918296 1:33986028-33986050 TCTGCCCTCAAGGAGCTCCCTGG - Intronic
904946994 1:34206674-34206696 TCAGCCCTCCATGAGCTCCAAGG - Intronic
906197398 1:43937383-43937405 CCTCCCATCCCGGAGCTGCTGGG - Intergenic
906263100 1:44407716-44407738 TCCGCAGTCCAGGAGCTGGAAGG + Intronic
908577882 1:65480378-65480400 TCTATGAACCAGGAGCTGCATGG + Intronic
908921170 1:69194589-69194611 TCTACCAACCAGGACTTGCATGG + Intergenic
909445432 1:75743587-75743609 TCTGCCATCCTGGGGATGCATGG - Intronic
910225503 1:84931939-84931961 TCTTGCATCCAGGAGGTTCAGGG + Intronic
910292777 1:85615544-85615566 TCTGCCACCCAGTAGCTGTGTGG - Intergenic
912487359 1:110039710-110039732 TCTGGCATCAGGGAGCTGCAGGG - Intronic
913247822 1:116885691-116885713 CCTGCCCTCCAGGAGCTTCCAGG - Intergenic
915240954 1:154521363-154521385 CTTGCAATCCAGGAGCTGAATGG + Exonic
915347988 1:155207797-155207819 TCTGCCAGTCAGGATCTGCAGGG - Exonic
916183287 1:162106241-162106263 TGGCCCATCCAGGAGCTGCACGG - Intronic
916245012 1:162678643-162678665 TCTGCCCTCCAGGACAAGCATGG - Intronic
917963749 1:180165915-180165937 TCTGGAATCCAGGAACTGCGGGG - Intronic
919745317 1:201005000-201005022 ACTGCCATCCGGGAGAGGCACGG + Intronic
921484124 1:215696440-215696462 TCTGTCACTCAGGGGCTGCATGG + Intronic
922607087 1:226896299-226896321 TCTGCCAGCCCTGAGCTGTAAGG + Intergenic
922794452 1:228333191-228333213 TCTGCCAGCCGGGAGCAGGAGGG + Exonic
924043709 1:240008203-240008225 GGGGCCATCCAGGAGCAGCAGGG + Intergenic
1062835195 10:630889-630911 TCTGCCATCCCTGTGCTCCAAGG - Intronic
1064112913 10:12553893-12553915 TCTGCCACATAGGAGCTGCAAGG - Intronic
1064457276 10:15499558-15499580 TCCACCATCCAGGGGCTGCCCGG - Intergenic
1065666940 10:28072995-28073017 ACTGCTGTCCAGGGGCTGCATGG - Intronic
1065694949 10:28371163-28371185 TCTGACTTCTAGGAGCTGCCTGG + Intergenic
1065816621 10:29488344-29488366 TCTGCCACCCAGTAGCTGCTGGG + Intronic
1065847505 10:29758146-29758168 TCTGCCCTTCAGAAGCTGGAAGG - Intergenic
1065956241 10:30696312-30696334 TCTGCCACCCAGTAGCTGCTGGG - Intergenic
1067317658 10:45183529-45183551 TCTGCCTTTCAGGAGCTTTAAGG + Intergenic
1069573164 10:69506753-69506775 TCTGGGAGCCGGGAGCTGCAGGG + Intronic
1070282176 10:75057990-75058012 TCTTCCCTCCAGGTGCTGCAGGG - Intronic
1070645698 10:78200761-78200783 TGTGCCAGCCAAGAGCTGCCAGG - Intergenic
1070734755 10:78855842-78855864 TCTGACTACCAGGGGCTGCAGGG + Intergenic
1071126234 10:82338472-82338494 TCTGCCTCCCAGGAGCAACAAGG - Intronic
1072338558 10:94423209-94423231 TCTGCCTTCCAAGAGATGCTTGG + Intronic
1072736166 10:97881107-97881129 TCTGCAATTCAGCAGCTGGAGGG + Intronic
1073111501 10:101065657-101065679 TCTGGCTTCCAGAAGCTGCAGGG + Intronic
1074113558 10:110439241-110439263 TCTTCCAGCCAGCAGGTGCAAGG + Intergenic
1074454520 10:113585802-113585824 TTTGGCATCCAGGAGCTGGCGGG - Exonic
1075093533 10:119456579-119456601 TGTGCCACCCAGCAGCTGCCAGG + Intronic
1075622527 10:123938575-123938597 TGTGACCTCCTGGAGCTGCAAGG + Intronic
1075873145 10:125785825-125785847 TCCTCCATCCAGGAGCTGGAGGG + Intronic
1076036906 10:127206616-127206638 AATGCCATCCAGGAGGTGGAGGG - Intronic
1076047887 10:127309317-127309339 TCTGATATCCAGAATCTGCAAGG - Intronic
1076290688 10:129343353-129343375 GCTGCCATCCAGGAGAGGCCAGG - Intergenic
1076548516 10:131261991-131262013 GGTGCCTTCCAGGAGCTGCAAGG + Intronic
1076867885 10:133177094-133177116 TCTGCCAGGCAGCAGCTGCATGG - Intronic
1077002302 11:330364-330386 GGTGCCTTCCAGGAGCTGCTGGG + Intergenic
1077594560 11:3520603-3520625 TCTGCCCTCCAGGAGTTTCTAGG - Intergenic
1078244725 11:9563666-9563688 TGTGCCATGCAGCAGCTGCTGGG + Intergenic
1078423719 11:11232785-11232807 TCTGCCTCCCAGCAGCAGCAAGG - Intergenic
1078722589 11:13898107-13898129 CCTGCCAGCCAGGCCCTGCAAGG - Intergenic
1079087456 11:17456885-17456907 CCTGACACCCAGGAGATGCACGG - Intronic
1080816370 11:35761305-35761327 TCTGCCATTCGGGAGCTTGAAGG - Intronic
1081691780 11:45083280-45083302 TCTGCCCTCCAGGAACTTCCAGG + Intergenic
1083518027 11:63278778-63278800 TCTGCCATCCAGGCGGTTCATGG + Intronic
1084250406 11:67893874-67893896 TCTGCCCTCCAGGAGTTTCTAGG - Intergenic
1084542908 11:69798413-69798435 TCTGCCAGGGAGAAGCTGCATGG + Intergenic
1084653862 11:70503996-70504018 GCTCCCATTCAGGAGCTGCTGGG - Intronic
1084800333 11:71539398-71539420 TCTGCCATCGAGGTGCCTCAGGG + Intronic
1084822376 11:71701468-71701490 TCTGCCCTCCAGGAGTTTCTAGG + Intergenic
1085351268 11:75799342-75799364 TCTTCCATCCAGCAGCTCCAAGG - Intronic
1087922636 11:103884058-103884080 TCTGTCATCCATGTGCTACATGG - Intergenic
1089163213 11:116455435-116455457 TCTGCAGCCCAGGAGCTGCTGGG + Intergenic
1089296523 11:117472211-117472233 TCTCCCAAGCTGGAGCTGCATGG - Intronic
1090471309 11:126983704-126983726 GCTGGCATCCAGGTGCTGCAGGG - Intronic
1091678250 12:2507218-2507240 TCAGTGATTCAGGAGCTGCAAGG - Intronic
1091912376 12:4242851-4242873 TCTGCACTCCAGGAGCCGCAAGG + Intergenic
1092420734 12:8329392-8329414 TCTGCCCTCCAGGAGTTTCTAGG - Intergenic
1092952394 12:13518756-13518778 TCTACCATCCAGAGGCTACAAGG - Intergenic
1096215036 12:49793859-49793881 GCTGCCATCCAAGAGCTGGCGGG - Exonic
1098700754 12:73622493-73622515 TCTGATATCCAGAATCTGCAAGG - Intergenic
1100176076 12:92032393-92032415 TGTGCAATCCAGGAGCTGTCAGG + Intronic
1101054845 12:100901829-100901851 TCTTCCACCCAGGTGATGCATGG + Exonic
1101448985 12:104759235-104759257 ACTGCCATGCATGAGCAGCAAGG + Exonic
1102050414 12:109857762-109857784 CCTGCCCTCCAGGAACAGCAGGG + Intronic
1103017500 12:117507248-117507270 TTTGCCATCCTGGTGCTGAATGG - Intronic
1103936834 12:124481480-124481502 GCTGCCCTCCAGGGCCTGCATGG - Intronic
1104365797 12:128175678-128175700 TCTGCTATCCAACAACTGCAAGG - Intergenic
1104418209 12:128613204-128613226 GGTGCTGTCCAGGAGCTGCATGG - Intronic
1105719015 13:23095549-23095571 TCTGCCATCTTGGAGCTTCTAGG + Intergenic
1105871989 13:24513204-24513226 TCTGCCATTCAAGAGAGGCAGGG + Intergenic
1106619750 13:31361933-31361955 TCATCCATCCAGGAGCAGGAAGG - Intergenic
1106786487 13:33113100-33113122 TCTGCCTCCCATGAGCTGCGAGG - Intronic
1110162321 13:72393264-72393286 TCTGCCACCCAAGCTCTGCACGG + Intergenic
1113914389 13:113862189-113862211 GCTGTCCTCCAGGACCTGCAGGG - Intronic
1114757037 14:25270896-25270918 TCTTCCCTCCAGAAGATGCAGGG - Intergenic
1115956662 14:38788205-38788227 TTTTCCATCCAGGACCTGGATGG - Intergenic
1117377493 14:55129443-55129465 TCTGCCCTCCAGGAGCGGGGCGG + Intronic
1119013348 14:71020651-71020673 TCTGACATCCAGAATCTACAAGG - Intronic
1119471268 14:74901177-74901199 TCTGCCATCCTGGGGATGCATGG + Exonic
1120484121 14:85088784-85088806 TCTGACATGCAGGGGCTGCGTGG + Intergenic
1122542737 14:102507132-102507154 TCGGCCCGCCAGGAGCTGCTGGG - Exonic
1122971237 14:105153068-105153090 GCTGCCATCCAGGCCCTGCCGGG + Intronic
1123687150 15:22806852-22806874 TCTGCCCTGCAGGAAGTGCATGG - Intronic
1123968968 15:25486718-25486740 TATGCCGTCCAAGATCTGCAGGG - Intergenic
1126111765 15:45179404-45179426 CCTGCCCTCCAGGAGCCACAGGG - Intronic
1127983695 15:64052061-64052083 TCTGCCCTCCCTGACCTGCATGG + Intronic
1127986064 15:64071575-64071597 TCTAGCTTCCAGGAGCAGCAGGG + Intronic
1128134909 15:65255604-65255626 CTTGCCCTCCAGGAGCTCCAGGG - Intronic
1128262255 15:66240717-66240739 TCTGCCATGCACTAGCTGCATGG - Intronic
1128444409 15:67744485-67744507 TCTTCCAGACAAGAGCTGCAGGG + Intronic
1128757658 15:70194463-70194485 TCTGCCTTCCAGGAACTGGTTGG - Intergenic
1129689048 15:77702908-77702930 CCTGCCCTCCAGGAGCTGCTGGG - Intronic
1133281534 16:4668257-4668279 GCTGCCGTCCATGTGCTGCAGGG - Exonic
1133359451 16:5162438-5162460 TCTGCCCTCCAGGAGTTTCTAGG - Intergenic
1134378064 16:13697612-13697634 TCTGCCTTCCTGGAACTGCCAGG - Intergenic
1135975283 16:27104681-27104703 TCTGCCTCCCAGGATCTACACGG + Intergenic
1136566362 16:31073118-31073140 CCTGCCCTCCAGGGGCTGCCTGG - Intronic
1137019202 16:35406754-35406776 TCCAGCATCCAGGATCTGCAAGG + Intergenic
1137506377 16:49057482-49057504 TCTGCCCTCCTGGGACTGCATGG + Intergenic
1138175617 16:54895737-54895759 TCTGCCACCAAGGGGCTCCATGG - Intergenic
1138511062 16:57508623-57508645 TCTGTCCTCCAGGAGCAGCCAGG + Intergenic
1138599578 16:58046683-58046705 TCTGCCACCCAGGATCCCCAAGG + Exonic
1140122946 16:72099109-72099131 GCTGCCCTTCTGGAGCTGCATGG + Intronic
1140967919 16:79985110-79985132 TCTGCCATTTACCAGCTGCATGG + Intergenic
1141151663 16:81568506-81568528 TGTGCCAGGCAGGAGCTCCAGGG + Intronic
1141242923 16:82279618-82279640 TCTGCCACATAGGAACTGCATGG - Intergenic
1142314979 16:89338068-89338090 TCTGCCACTCAGGAGCCCCAGGG + Intronic
1142782489 17:2192080-2192102 TTTGCCATCCTGGAGCTGTCAGG - Intronic
1143059051 17:4184817-4184839 TCTGTCATCCTGGAGCAGAAAGG - Exonic
1143662735 17:8336749-8336771 TCTCCCCTCCAGCAGCTGGAGGG + Intergenic
1143689937 17:8552870-8552892 TCTGAAATGCAGGAGCTGCTGGG - Intronic
1145932385 17:28695206-28695228 TCTGCCATTCAGCAGCTGGCTGG + Intronic
1148458328 17:47822844-47822866 TCTGGCATCCAGGAGCCTCAAGG + Intergenic
1148464945 17:47859331-47859353 TGTGCCAGCCAGGAGCTTGAAGG - Intergenic
1148945253 17:51256871-51256893 TCTGCCATTGAGTAGCTCCATGG - Intronic
1151412913 17:73942957-73942979 TCTGCCCTCCATGAGGAGCATGG - Intergenic
1151702728 17:75752073-75752095 GGTGCCATCCAGGGGATGCACGG + Intronic
1152204468 17:78967244-78967266 GCTGCCCTCCATGAGCTGGAAGG + Intergenic
1152561940 17:81083024-81083046 TCGCCCTTCCAGGAGCTGCGGGG - Intronic
1153095136 18:1392337-1392359 TCTGTGCTCCAGGAGCTGGAGGG - Intergenic
1153126429 18:1797552-1797574 TCTGCCCTCAAGGAGCTAAAGGG - Intergenic
1153779632 18:8483085-8483107 TCTGTCATCCAGGCCCTGCCAGG + Intergenic
1155154903 18:23149964-23149986 TCTGCTATCCAGGTAATGCAGGG + Intronic
1156192106 18:34731698-34731720 TCTGCCATCAGGGAACTTCAGGG - Intronic
1156307267 18:35888688-35888710 TATAACATCCAGGAGCAGCATGG - Intergenic
1157003867 18:43559250-43559272 CCTGCCATCCAGGTGCTTCCTGG + Intergenic
1158286241 18:55887309-55887331 TCTTGCTTCCAGGAGCAGCAAGG + Intergenic
1158488960 18:57893086-57893108 GCTGCCATCCAGGAGCCACCAGG - Intergenic
1158951650 18:62500453-62500475 TCTGCCTTCCTGAAGCTGCTGGG - Intergenic
1159279197 18:66262878-66262900 TTTGCCATCTAGTATCTGCATGG + Intergenic
1159299605 18:66545785-66545807 TCAGCCATCCTGGAAATGCAAGG + Intronic
1159648973 18:70954787-70954809 TCTGCCATCCCGAGGGTGCATGG + Intergenic
1160505138 18:79422744-79422766 TCTCCCACCCTTGAGCTGCAAGG + Intronic
1162054868 19:8056431-8056453 TCGAGCATCCAGGAGCTTCATGG - Exonic
1162222753 19:9192127-9192149 TCTGCCATGCAGCTGCTGCAGGG - Intergenic
1162430881 19:10627710-10627732 TCTGCTCCCCAGGGGCTGCACGG + Exonic
1162937497 19:13988554-13988576 TCAGCCATGCAGGAGCTGATGGG + Intronic
1163378290 19:16947630-16947652 TCTGACATCATGGAGCTGCACGG - Intronic
1163819131 19:19486257-19486279 GCTTCCATCTGGGAGCTGCAAGG + Intronic
1164278714 19:23749012-23749034 TCTGCAATGCAGGAGCTAGAAGG + Intronic
1164638014 19:29805637-29805659 CCTGCCCTCCAGGAGCTCCCAGG - Intergenic
1166060339 19:40321778-40321800 TGTGTCATCCAGGAGCTGGTGGG + Exonic
1166209455 19:41296799-41296821 GCTGAGATCCAGGAACTGCAGGG - Intronic
1166793914 19:45414802-45414824 TCAACCACCCAGGAGCTGCGGGG + Intronic
1167251482 19:48400641-48400663 TCTTCCATCCAGGGGCAGCACGG - Intronic
1167807639 19:51799697-51799719 TCTGCCCTCCTGCAGCTGCTGGG - Intronic
1167810843 19:51828883-51828905 CCTGCCCTCCAGGAGCTGCAGGG - Intergenic
925348454 2:3186079-3186101 CCTGCCATCCACCAGCTGCCAGG + Intergenic
925615651 2:5742374-5742396 TTTGCCAAGCAGGAGCTGCAAGG + Intergenic
925897893 2:8487487-8487509 TCTGCCCTCCAGGGGCTGCCAGG + Intergenic
926045993 2:9710022-9710044 CATGCAATCCAGGAGTTGCAGGG - Intergenic
926218122 2:10917915-10917937 TCTGCCACCAACGAGCAGCAAGG - Intergenic
926729221 2:16022698-16022720 TCTGCCATCCACTAGCTGTGGGG - Intergenic
927151302 2:20198061-20198083 TCTGCCCTCCAGGAGCACCCAGG + Intergenic
927937510 2:27083958-27083980 ACGGTCCTCCAGGAGCTGCAGGG - Exonic
927978104 2:27355665-27355687 GCTGGCATCCTGGAGCAGCATGG - Intronic
928245198 2:29620588-29620610 TCTGCCATTCAGCAGCTGCATGG + Intronic
930100524 2:47599620-47599642 AATGCCCTCCAGGAGCTGCCTGG - Intergenic
930261430 2:49151246-49151268 TCTGCCATCCAGGAGCTGCAGGG + Intronic
931808009 2:65826772-65826794 CCTGCCAGCCAGGAGCAACAGGG - Intergenic
932306286 2:70706038-70706060 TCTGCCATCCACCAGTTACAAGG + Intronic
932306790 2:70709522-70709544 TCTGTCACTCAGTAGCTGCATGG + Intronic
933377422 2:81497701-81497723 TCTCCCGTCCAGGAGCTGGTAGG + Intergenic
933918659 2:87022331-87022353 TTTGTCATCCAGGACCTGAAAGG - Intergenic
934004336 2:87747584-87747606 TTTGTCATCCAGGACCTGAAAGG + Intergenic
934101703 2:88659594-88659616 TTTGGGATTCAGGAGCTGCAAGG - Intergenic
935373331 2:102370161-102370183 CCTGCCATCCAGGAGCTCCAAGG - Intronic
937029447 2:118725936-118725958 TCTGACATCCAGGAGCTTACAGG - Intergenic
938067573 2:128289614-128289636 TCTGCCATCCAGCAGCTGTGTGG + Intronic
938548115 2:132353247-132353269 TCTGCCCTGCAGCAGCTGCACGG + Intergenic
938701090 2:133880726-133880748 CCTGCCACCCAAGAGCTGCTAGG - Intergenic
939000426 2:136728083-136728105 TCTGCTATTCAGGAGCTTCCTGG + Intergenic
939087813 2:137742826-137742848 TCTGGCAGGCAGGAGCAGCAGGG - Intergenic
939096042 2:137834570-137834592 CCTGCCGTCCAGGTGCAGCATGG - Intergenic
943800009 2:192045766-192045788 CCTGCCACCCAGGAGCTGGCTGG - Intronic
945243582 2:207698404-207698426 TCTGCCATCAAGGTGCTGGCAGG + Intergenic
946060550 2:216937312-216937334 TCTGCCTTCCAGAAGCTCCAGGG + Intergenic
947210825 2:227707064-227707086 TCTGCCGTGCAGGTGCAGCAGGG - Intronic
947218239 2:227768394-227768416 TCTCCTTTTCAGGAGCTGCAGGG + Intergenic
947331580 2:229034601-229034623 TCAGCCATCAAGGAGTTGCAGGG + Intronic
947841810 2:233212633-233212655 TGTGCCTGCCAGGAGCGGCACGG + Intronic
1168812181 20:711293-711315 TCTTCCATCCAAGAACAGCATGG + Intergenic
1168879458 20:1194306-1194328 TTTGCCCTCAAGGAGCTGCTAGG - Intergenic
1169206618 20:3744295-3744317 ACAGCCCTCTAGGAGCTGCAGGG + Intronic
1169324508 20:4664441-4664463 TTAGCCATCCATGAACTGCAGGG - Intergenic
1171876984 20:30586019-30586041 TCTGCCCTGCAGCAGCTGCACGG + Intergenic
1172375339 20:34434535-34434557 TCTGCCATCCAGGACATGATAGG + Intronic
1173080591 20:39863329-39863351 TCCCCAATCCAGGAGCTGAAGGG + Intergenic
1173367908 20:42404278-42404300 TCAGCCATCCAGACCCTGCAGGG + Intronic
1173906709 20:46634861-46634883 TCTCCCATCATGGAGCGGCATGG + Intronic
1175153639 20:56954736-56954758 CCTGCCATCCAGGGGCTTCGTGG - Intergenic
1175240940 20:57548312-57548334 TCTGGTCTCCAGGATCTGCACGG + Intergenic
1175270749 20:57732228-57732250 CCTGCCTTCCACGAGCTGCCTGG + Intergenic
1175742391 20:61429288-61429310 TCTGCCTTTCACCAGCTGCATGG - Intronic
1175916311 20:62427605-62427627 TCTCCCAGCCAGGAGCAGAAAGG + Intergenic
1175968850 20:62673776-62673798 TCTGCAGTCCAGGTGCTACAGGG - Intronic
1176115828 20:63431603-63431625 TCGGGCTTCCAGGAGGTGCAGGG + Intronic
1177320490 21:19513679-19513701 CCTGCCATCCAGAAGCTTCCTGG - Intergenic
1177357459 21:20028005-20028027 TCTGAGAACCAGGAGCTCCAAGG - Intergenic
1177357629 21:20030395-20030417 TCTGAGAACCAGGAGCTCCAAGG - Intergenic
1178448902 21:32673339-32673361 GCTGGCATCCAGGAGTTTCAAGG - Exonic
1179226969 21:39462680-39462702 TCTGCCATCCAATAGCTGGATGG + Intronic
1179657699 21:42855376-42855398 TCTGCCAGCCAGGTGGGGCAGGG - Intronic
1179800842 21:43810890-43810912 CCTGCCCTCTAGGACCTGCATGG + Intergenic
1180968411 22:19802383-19802405 TCAGCCATCCAGGGGCTGTGTGG - Intronic
1180984488 22:19896501-19896523 TCTGCCATCCAGGAGCCAGGAGG + Intronic
1180992280 22:19943882-19943904 TGTGGCATGCAGGAGCTGGAGGG + Intronic
1182280954 22:29217419-29217441 TCTGCCACACACCAGCTGCATGG + Intronic
1183021689 22:35032634-35032656 TCTGTCCTCGAGGAGCTGCAAGG + Intergenic
1183675379 22:39296396-39296418 TCTCCCATCCCGCAGCTACAGGG + Intergenic
1183716611 22:39536938-39536960 TCTGTCGTCCAGGGTCTGCAGGG + Intergenic
1185082481 22:48717730-48717752 TCTGCCCTCCAGGAGCCACACGG + Intronic
949898790 3:8792830-8792852 TCAGCCACTCAGCAGCTGCAGGG + Intronic
950519419 3:13487741-13487763 TCTGTGATCTAGGTGCTGCAGGG + Intronic
951832232 3:26943282-26943304 TCTTCCATTCAGGAGCCACAGGG - Intergenic
952271211 3:31833458-31833480 CCTGACATGCAGAAGCTGCATGG + Intronic
952736352 3:36695270-36695292 CCAGCCCTCCAAGAGCTGCAAGG + Intergenic
952982465 3:38748708-38748730 TCTGCCATTCTGGAGCCACAGGG + Intronic
953032728 3:39188769-39188791 TCAGAGATCCAGGAGCTGAAGGG - Exonic
953568539 3:44053557-44053579 TCTGCCCTCCAGGACTTGTACGG - Intergenic
953815803 3:46155160-46155182 TCTGCCATCCGGTAGCTGGTGGG - Intergenic
953849013 3:46450915-46450937 CCTGCCAGGCAGCAGCTGCACGG - Intronic
956587873 3:70883387-70883409 TCTGCAAATCAGAAGCTGCAAGG + Intergenic
957813275 3:85256162-85256184 GCTGCTAACCAGGAGCTGCAGGG - Intronic
958432945 3:94063357-94063379 TCAGCCCTCCAAGAGCTGGAGGG - Intronic
961288655 3:125827438-125827460 TCTGCCCTCCAGGAGTTTCTAGG + Intergenic
961824557 3:129592258-129592280 TCAGCAATCCTGCAGCTGCAGGG + Intronic
961898410 3:130188592-130188614 TCTGCCCTCCAGGAGTTTCTAGG - Intergenic
966817575 3:183901656-183901678 TCTGTCATCTAGGATCTGCAAGG + Intergenic
966983902 3:185162434-185162456 TCCTGCATTCAGGAGCTGCAGGG + Intergenic
968574644 4:1359961-1359983 TCTGACTTCCAGGAGGTGAAAGG + Intronic
968652629 4:1766276-1766298 CCTGCCACCCAGGAGATGAAAGG + Intergenic
968763095 4:2452394-2452416 TGTGCCCACCGGGAGCTGCAGGG + Intronic
969008597 4:4042056-4042078 TCTGCCCTCCAGGAGTTTCTAGG - Intergenic
969097118 4:4741830-4741852 TCTGCCATCCAGTATCAGCTGGG + Intergenic
969804375 4:9595332-9595354 TCTGCCCTCCAGGAGTTTCTAGG + Intergenic
970401237 4:15719757-15719779 TCTGCCTTCCAGCAGCCCCATGG + Intronic
973771770 4:54213428-54213450 GCTGCGATGCTGGAGCTGCAGGG + Intronic
978298984 4:107243506-107243528 GCAGCCAACCTGGAGCTGCAGGG + Intronic
978776169 4:112509315-112509337 TCTGCGATCCAAAAGCTGCTGGG + Intergenic
979529521 4:121754298-121754320 TCTAATATCCAGGATCTGCAAGG + Intergenic
979692211 4:123572114-123572136 TCTGCTATCCAGAATCTGTAAGG + Intergenic
980021664 4:127717866-127717888 TCTGATATCCAGGATCTACAAGG - Exonic
980222034 4:129930060-129930082 TCTTGCAGCCAGGGGCTGCATGG - Intergenic
983247556 4:165305700-165305722 GTTGCCTTCCAGGAGGTGCAGGG + Exonic
984053835 4:174900905-174900927 TCTGAAATCCAGGAGTTGAAAGG - Intronic
985201010 4:187485624-187485646 CCTGTAATCCAGGAGCTACAAGG - Intergenic
985492399 5:187381-187403 GCTGCCATCCAGGAGGGGCCCGG - Exonic
985520142 5:370409-370431 TCTCCCGTCCAGGAGTTGGATGG - Intronic
986043685 5:4017330-4017352 CCTGCCATCCAGGAACACCAGGG + Intergenic
990608179 5:57430925-57430947 TCTGCCAGGCAGGACCTCCATGG + Intergenic
994191095 5:96870178-96870200 TCTGACAGCCAGGAGCTGAATGG + Intronic
995530209 5:113085006-113085028 CCTTCTATGCAGGAGCTGCAAGG - Intronic
996906698 5:128609020-128609042 TCTGCCATGCAGCTGCTGCGGGG + Intronic
997963771 5:138341707-138341729 TCTGCGATTCATGAGCTACAGGG - Intronic
998381554 5:141729602-141729624 TCTGCCTGCTTGGAGCTGCAGGG + Intergenic
998613614 5:143716143-143716165 TCTGCCATTTAGGAGCTGTGTGG + Intergenic
999112520 5:149134399-149134421 TCTACCTTCCAGGGGCTCCAGGG - Intergenic
999250109 5:150177417-150177439 TCTAGCATGCAGGAGGTGCATGG - Intronic
1000743597 5:165001517-165001539 CCTGCCATCCAGGAGCTGATGGG - Intergenic
1000792286 5:165622538-165622560 TCTACCACCCAGAAGCTTCAGGG + Intergenic
1001856260 5:175013254-175013276 AGTGCCGTCCAGGAGGTGCATGG - Intergenic
1001942432 5:175750303-175750325 TCTTCCAACCAGAACCTGCAAGG + Intergenic
1003351870 6:5325392-5325414 CCTGCCATCCAGTGGCGGCAGGG + Intronic
1004011364 6:11691203-11691225 TCTGTCCTCTAGGTGCTGCAAGG - Intergenic
1004469916 6:15920168-15920190 TCTCCCTTCAGGGAGCTGCAGGG + Intergenic
1006798771 6:36746417-36746439 TCTGCCATCCGGGGGCAGCTTGG + Exonic
1009548064 6:65047812-65047834 TCTGCCACCCAGGAGCTGAGTGG + Intronic
1016768096 6:147817701-147817723 TGTGGGATCCAGGAACTGCATGG + Intergenic
1017032780 6:150238654-150238676 CCTGCCTTCCAGGAGCTCCCAGG - Intronic
1018446524 6:163863695-163863717 TCTGCCACCCTGCAGGTGCAGGG + Intergenic
1018919419 6:168161113-168161135 TCTGCCCTCCGGGTGCTCCAAGG - Intergenic
1019145837 6:169975190-169975212 TCTGCCCTTCAGGAGCTACAGGG - Intergenic
1020100412 7:5391189-5391211 TCTCCCAGGCAGGAGCTGCCAGG + Intronic
1020329065 7:6999853-6999875 TCTGCCCTCCAGGAGTTTCTAGG - Intergenic
1020868136 7:13591453-13591475 TGGCCCATCCAGGAGCAGCATGG - Intergenic
1021606531 7:22414448-22414470 AATCCCATCCAGGAGATGCAGGG + Intergenic
1021839269 7:24709291-24709313 TCTGCTACCCAGTGGCTGCAGGG + Intronic
1022763366 7:33381360-33381382 TCTGCCCTCAAGGAGCTCCCAGG - Intronic
1024056387 7:45662233-45662255 CCTGCCATGCTGGAGCTGCCAGG + Intronic
1024945325 7:54802302-54802324 CGTGCCAGCCAGGAGCTGCTTGG - Intergenic
1024950450 7:54855478-54855500 TCTCCCATCCAGGAGTTACATGG + Intergenic
1029586744 7:101477513-101477535 TCTGCCAGCTAGGAGCTGAGGGG + Intronic
1033690362 7:143730481-143730503 TCTGATATCCAGAATCTGCAAGG - Intergenic
1035425929 7:158773152-158773174 TCTGCCTGCCGGGAGCTGCTGGG - Intronic
1036172302 8:6499917-6499939 TCTGACTTACGGGAGCTGCAGGG - Exonic
1036249878 8:7152713-7152735 TCTGCCCTCCAGGAGTTTCTAGG - Intergenic
1036367622 8:8134723-8134745 TCTGCCCTCCAGGAGTTTCTAGG + Intergenic
1036883258 8:12530938-12530960 TCTGCCCTCCAGGAGTTTCTAGG - Intergenic
1037458275 8:19084453-19084475 TCTGCCACCCAGGATCTGTGGGG - Intronic
1037518930 8:19661226-19661248 TCTGTCACCCAGGAGCCACAAGG + Intronic
1038186223 8:25277562-25277584 TCTGCCACCAAAGAGCTGTACGG - Intronic
1038400393 8:27280081-27280103 TCTGGAGTCCAGGATCTGCACGG - Intergenic
1038455988 8:27672261-27672283 TCTGCCCTTCAGGAGCAGCCTGG + Exonic
1038686560 8:29724240-29724262 CCTCCCATCCAGGTGCAGCACGG + Intergenic
1038755846 8:30340112-30340134 TCTGCCAACTGTGAGCTGCAGGG + Intergenic
1040286612 8:46103715-46103737 TCTGCCATCCAGAAGCCCCCAGG - Intergenic
1040383967 8:46900751-46900773 TCTCCCATCCAGGATCTGCCAGG - Intergenic
1041381418 8:57257951-57257973 CCTGCCCTCCTGCAGCTGCAGGG - Intergenic
1042359504 8:67866777-67866799 TCTGCCATCCAGCTGCTGGCAGG + Intergenic
1045989135 8:108285375-108285397 TCTGACATCCAGGAGCTGGCTGG - Intronic
1047510704 8:125513233-125513255 TACGCAATCCAGGAGCTGCTGGG - Intergenic
1047569916 8:126086299-126086321 TCTCCCATCCAGGATCTAGAAGG + Intergenic
1047795340 8:128249510-128249532 CCTGCCTTCCAGGAGTTTCAGGG + Intergenic
1048259952 8:132936909-132936931 TCTGCCACATATGAGCTGCATGG + Intronic
1048819336 8:138365884-138365906 TCTGCCATACAGAAACAGCAAGG + Intronic
1049013731 8:139905491-139905513 TCTGCTTCCCCGGAGCTGCACGG - Intronic
1049222920 8:141436058-141436080 TCTGCCTTGCAGGAGCGGGACGG - Intergenic
1049224161 8:141441696-141441718 TTTGCCCACCTGGAGCTGCAGGG - Intergenic
1049224266 8:141442088-141442110 GCTGCCATCCTTGAGCTGAAGGG - Intergenic
1049540911 8:143208354-143208376 CCTGCCTTCCAGGGACTGCAGGG + Intergenic
1049608150 8:143539246-143539268 GCTGCCACCCAGAAGCTGCTGGG + Exonic
1050531656 9:6595617-6595639 TCTGCCAACCAAGAGTTGAATGG + Intronic
1052872640 9:33523669-33523691 TCTGCCCTGCAGCAGCTGCACGG + Intergenic
1053752320 9:41269184-41269206 TCTGCCCTGCAGCAGCTGCACGG - Intergenic
1053752770 9:41273441-41273463 TCTGCCCTGCAGCAGCTGCACGG - Intergenic
1054257847 9:62833516-62833538 TCTGCCCTGCAGCAGCTGCACGG - Intergenic
1054258295 9:62837793-62837815 TCTGCCCTGCAGCAGCTGCACGG - Intergenic
1054333475 9:63782248-63782270 TCTGCCCTGCAGCAGCTGCACGG + Intergenic
1054351584 9:64021294-64021316 TCTGTCCTGCAGCAGCTGCACGG + Intergenic
1054766546 9:69047150-69047172 CCTGCCAACCAGTATCTGCATGG + Intronic
1056877616 9:90349685-90349707 TCTGCCATCCAGGTGCTTCCTGG - Intergenic
1057448750 9:95137868-95137890 GCTGCCATCCAGGGCCTGCCCGG - Intronic
1059510105 9:114837011-114837033 TGGCCCACCCAGGAGCTGCATGG - Intergenic
1059845674 9:118273711-118273733 TCTGCCATCACGGAAGTGCAAGG - Intergenic
1061163761 9:128910909-128910931 TCTGCCATGCAGCAGCCCCACGG + Intronic
1061214387 9:129212616-129212638 GCTGCCGTCCAGGAGATGAAAGG + Intergenic
1061630993 9:131872110-131872132 TCCACCAGCCAGGAGCTGGAAGG - Intronic
1062534303 9:137014796-137014818 GCTGCGCTCCAGGTGCTGCAGGG + Exonic
1202800478 9_KI270719v1_random:170582-170604 TCTGCCCTGCAGCAGCTGCACGG + Intergenic
1202800924 9_KI270719v1_random:174864-174886 TCTGCCCTGCAGCAGCTGCACGG + Intergenic
1185458182 X:320688-320710 CCTCCAATCCAGGCGCTGCAGGG - Intergenic
1188381408 X:29497448-29497470 TCTTCCATGTAGGAGCTACATGG + Intronic
1189335433 X:40168278-40168300 TCTGCCTCCCAGGAGCTGTCCGG - Intronic
1189550635 X:42088897-42088919 TCTTGCATCCAGACGCTGCATGG - Intergenic
1189873015 X:45404363-45404385 CCTGCCATCCAGGTGCTTCTTGG - Intergenic
1191039948 X:56068380-56068402 TCTGCCATCCAGGTGTTGCTTGG - Intergenic
1192451892 X:71249949-71249971 CCTCCCATCCTGGGGCTGCAGGG - Intronic
1195399595 X:104447373-104447395 TCTTCCATCTAAGATCTGCAGGG + Intergenic
1196358011 X:114817667-114817689 TCCCCCATCCAGTAGCTGCCAGG - Intronic
1197977516 X:132181486-132181508 GATCCCTTCCAGGAGCTGCAGGG + Intergenic
1202050320 Y:20774179-20774201 TCTGCCATCCAGAAGATAGAGGG - Intronic
1202331174 Y:23754689-23754711 TCATCCATCCAAGAGCAGCAGGG - Intergenic
1202539595 Y:25915371-25915393 TCATCCATCCAAGAGCAGCAGGG + Intergenic