ID: 930261789

View in Genome Browser
Species Human (GRCh38)
Location 2:49155219-49155241
Sequence AGTGCTGGGCTGTCACCTCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 215
Summary {0: 1, 1: 0, 2: 0, 3: 20, 4: 194}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
930261789_930261795 8 Left 930261789 2:49155219-49155241 CCCTGAGGTGACAGCCCAGCACT 0: 1
1: 0
2: 0
3: 20
4: 194
Right 930261795 2:49155250-49155272 CATTCCCCTCCTCGATGGTGAGG 0: 1
1: 0
2: 1
3: 1
4: 81
930261789_930261802 26 Left 930261789 2:49155219-49155241 CCCTGAGGTGACAGCCCAGCACT 0: 1
1: 0
2: 0
3: 20
4: 194
Right 930261802 2:49155268-49155290 TGAGGGATCTGAGGAACGTTTGG 0: 1
1: 0
2: 0
3: 10
4: 98
930261789_930261796 9 Left 930261789 2:49155219-49155241 CCCTGAGGTGACAGCCCAGCACT 0: 1
1: 0
2: 0
3: 20
4: 194
Right 930261796 2:49155251-49155273 ATTCCCCTCCTCGATGGTGAGGG 0: 1
1: 0
2: 1
3: 13
4: 85
930261789_930261794 3 Left 930261789 2:49155219-49155241 CCCTGAGGTGACAGCCCAGCACT 0: 1
1: 0
2: 0
3: 20
4: 194
Right 930261794 2:49155245-49155267 GTTGGCATTCCCCTCCTCGATGG 0: 1
1: 0
2: 0
3: 1
4: 63
930261789_930261801 17 Left 930261789 2:49155219-49155241 CCCTGAGGTGACAGCCCAGCACT 0: 1
1: 0
2: 0
3: 20
4: 194
Right 930261801 2:49155259-49155281 CCTCGATGGTGAGGGATCTGAGG 0: 1
1: 0
2: 0
3: 6
4: 90

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
930261789 Original CRISPR AGTGCTGGGCTGTCACCTCA GGG (reversed) Intergenic
900726320 1:4218648-4218670 AGAGGTGGTCTGTCACCTCTGGG + Intergenic
904806856 1:33138051-33138073 GGTGCTGGGATTTCAGCTCAGGG + Intergenic
907020195 1:51059588-51059610 GGGGCTGGGCTGTCAGCTCCAGG + Intergenic
907051865 1:51335023-51335045 AGGGCCCAGCTGTCACCTCAAGG - Intronic
907515392 1:54990440-54990462 GGTGCTGGGCGTTCACCTGAGGG + Intronic
907826071 1:58017896-58017918 AGTGCTGGGCTGCAGCCTCAAGG - Intronic
908537453 1:65091390-65091412 ATTGCAGGGGTATCACCTCAGGG + Intergenic
911490951 1:98564997-98565019 ACTGCACGGCTGTCTCCTCAGGG - Intergenic
914246279 1:145887927-145887949 AGTGCTGGACGAACACCTCAAGG - Intergenic
914828852 1:151156166-151156188 AGTGCTGTGCTGGCACCTGCTGG + Intergenic
915269069 1:154739885-154739907 AGGGCTGTGGTCTCACCTCAAGG - Intronic
915974464 1:160375826-160375848 AGTGCTGGGATGTCAGCGCAGGG + Intergenic
916940858 1:169676279-169676301 AATGGTGGCCTGTAACCTCAGGG + Intronic
917796806 1:178538580-178538602 AGTGCTGAGCTCACATCTCATGG - Intronic
921675219 1:217968729-217968751 AGTGCTGGGCTGTCAGTTCCAGG + Intergenic
922410959 1:225374713-225374735 AATGCTGGGCTGTCCTCTCAGGG - Intronic
923296002 1:232595443-232595465 TGTGCTGGGCTGTCACTGCTGGG + Intergenic
1062933449 10:1368073-1368095 TGTGCTGGGCTCCCACGTCAGGG - Intronic
1066258351 10:33703942-33703964 AATGCTGGCCTCTCACCTCCTGG + Intergenic
1068443745 10:57094444-57094466 AGTGCTAGGATGTCACTTTATGG + Intergenic
1068814479 10:61294251-61294273 AGTTCTGAGCAGTCACCACATGG + Intergenic
1072877776 10:99191261-99191283 AGTGCCTGGCTGCCACCTAAGGG - Intronic
1073648128 10:105328191-105328213 AGTCCTGGGCTGTGACCTAGGGG + Intergenic
1074460965 10:113636408-113636430 TGAGGTGGGCTGTCATCTCAGGG - Intronic
1074776626 10:116772070-116772092 CGTCCTGTGCTGTCATCTCAGGG - Intergenic
1074912419 10:117923707-117923729 AGTGTTGGGCTGGAACCTAATGG + Intergenic
1076742481 10:132493590-132493612 TGTGCCTGGCTGTCTCCTCAGGG - Intergenic
1077045025 11:540900-540922 AGCCCTGGGATGTCACCCCACGG - Intronic
1077311363 11:1890338-1890360 CGTGCGGGGCTGTGACCTCCTGG + Exonic
1077434316 11:2531469-2531491 AGTGCTGAGCTGTGCCCCCAGGG + Intronic
1078639912 11:13084913-13084935 GGTGCTGGGCTGTCAGCTCCAGG - Intergenic
1080707249 11:34707902-34707924 AGTGCTGCCCTGTCACAGCAGGG - Intergenic
1081686794 11:45048628-45048650 AGAGCTGGGATGTCAGCTCTTGG - Intergenic
1083632701 11:64103987-64104009 AGTGCTGCCCAGTCACCCCAGGG + Exonic
1084345520 11:68545069-68545091 AGTACTGGGGGATCACCTCAAGG - Intronic
1084837601 11:71813928-71813950 CGTCCTGTGCTGCCACCTCATGG - Intergenic
1086955967 11:92934758-92934780 ACTGCAGGACTCTCACCTCAGGG + Intergenic
1087654181 11:100902784-100902806 AGTACTGCACTGTCACCTCTGGG + Intronic
1088908487 11:114172508-114172530 AGAGCTGCGCTGTGACCCCAGGG + Intronic
1091765557 12:3117904-3117926 CCTGCGGAGCTGTCACCTCAGGG + Intronic
1092401099 12:8180141-8180163 CGTCCTGTGCTGCCACCTCATGG + Intronic
1092914752 12:13179760-13179782 TGAGCTGGGCTGGCTCCTCAGGG - Intergenic
1097054892 12:56243377-56243399 AGTGCTGGGGTGTGACCTGCAGG + Exonic
1099687732 12:85910803-85910825 ACTGCTGAGCTGTCACCTGATGG - Intergenic
1100904810 12:99285796-99285818 AGTGCTGTGCTGTCATAACAGGG + Intronic
1102964020 12:117112466-117112488 AGTGGTGGGATCTCAGCTCACGG + Intergenic
1104422643 12:128649969-128649991 AATTCTGGGCTGTCACTGCAGGG - Intronic
1105630185 13:22156228-22156250 GGTCCTGGCCTGTCACCTCCTGG + Intergenic
1105641641 13:22270952-22270974 AGTGGCGGGATGTCACCTCTGGG + Intergenic
1106519305 13:30483153-30483175 AGTGCTGGGCTGCTACCCCTTGG - Intronic
1108042955 13:46356468-46356490 AATTCTGGGCTGCCACCACAAGG + Exonic
1110075008 13:71229194-71229216 AGTGCTGGGATTACAGCTCATGG - Intergenic
1111431759 13:88154978-88155000 AGTACTGGGATTTGACCTCATGG - Intergenic
1112265501 13:97919920-97919942 AGTCCAGAGCTTTCACCTCATGG + Intergenic
1113851194 13:113419162-113419184 AGTGATGTGATCTCACCTCACGG + Intergenic
1114483774 14:23050941-23050963 AGTGCTGGGCCCTTACCGCAGGG - Intronic
1114626168 14:24131620-24131642 ACTGCTGGGCTGCCTGCTCAAGG + Exonic
1118091825 14:62489862-62489884 AGTGGTGGGATCTCAGCTCACGG + Intergenic
1123812418 15:23941769-23941791 AGGGCTGGGCTCTCAACTGAAGG - Intergenic
1124103531 15:26717057-26717079 AGAGCTGGGCTGTCATCGGAGGG - Intronic
1125174657 15:36807035-36807057 AGTGATGAGCTGCCATCTCATGG + Intronic
1125645493 15:41268900-41268922 AGTGGTGGGATCTCAGCTCACGG - Intronic
1127046935 15:55035933-55035955 TGTGCTATACTGTCACCTCATGG - Intergenic
1128156996 15:65397318-65397340 AGTACTGGGCTGGGACCCCAGGG - Intronic
1129110013 15:73331794-73331816 AATGCTGGGCTGGCAGCTCCTGG - Intronic
1129243989 15:74268824-74268846 ACTGCTGGGCTGTGGGCTCAGGG - Intronic
1130853579 15:87821299-87821321 AGTGCAGGGAGGTCACCTCGTGG + Intergenic
1131217907 15:90554979-90555001 AGGGCAGGGCTGTCTCCTCCAGG - Intronic
1135134477 16:19877440-19877462 AGTGGGTGGCTGTCACCTCATGG - Intronic
1141630458 16:85284837-85284859 ATTGCTGAGATGTCAGCTCAAGG + Intergenic
1141982541 16:87559392-87559414 AGTGCTTGGCTGTCACTGAAGGG - Intergenic
1142174930 16:88640780-88640802 ACTGCAGGGCTGTCGGCTCAAGG + Intergenic
1142281533 16:89150706-89150728 AGTCCTGGGCTGTGACCGCATGG - Intronic
1143320099 17:6062699-6062721 AGGGTTGGCTTGTCACCTCATGG + Intronic
1143873405 17:9974117-9974139 AGTTCTGGTCTGTCAGCTGATGG + Intronic
1144711051 17:17401670-17401692 AGTGCTGGGATGTTGACTCATGG - Intergenic
1148051040 17:44770021-44770043 TGTGCTGGGTTGTCCCCTCCCGG - Exonic
1148351213 17:46943312-46943334 AGAGCTGGCCTGTCACATCAAGG - Intronic
1148647149 17:49225623-49225645 AGTGATGAGCTGTCAGCACAGGG - Intronic
1150317989 17:64186020-64186042 AATGCTGGGCTGTGACATCAGGG + Intronic
1150828124 17:68494573-68494595 AGTGCTGTGCTGGGACTTCAAGG + Intergenic
1152037322 17:77881284-77881306 GGGGCTGGGCTGATACCTCAGGG + Intergenic
1157434658 18:47658204-47658226 GGTGCTGGCCTGTGCCCTCAAGG - Intergenic
1157901545 18:51522911-51522933 AGTGATGGGCTGTAACTTCCAGG - Intergenic
1157975443 18:52322158-52322180 GGTGCTCTGATGTCACCTCATGG + Intergenic
1159945996 18:74445299-74445321 TGTGCTGGGCTGGCAGCTCTGGG - Intronic
1162829318 19:13274781-13274803 AGTTCTGGGCAGCCATCTCAAGG - Intronic
1164491782 19:28721231-28721253 AGTGCTGGGTTCTCAGCTGAGGG - Intergenic
1165307676 19:35012237-35012259 AGTGCTGAGATGTGACCCCAGGG - Intronic
1165748996 19:38248614-38248636 AGAGCTGGGCTGTCTCACCAAGG - Intronic
1166516733 19:43452732-43452754 AGTGCTGGGGAGTCACAACAGGG + Intergenic
1166551463 19:43668678-43668700 AGGGCGGGGCTGGAACCTCAAGG - Intronic
1166551511 19:43668887-43668909 AGGGCGGGGCTGGAACCTCAAGG - Intronic
1166731415 19:45061059-45061081 AGGGCTGGGCAGTCCCCACAGGG + Intronic
926883988 2:17579935-17579957 GGTGCTGAGATGTCACCTCAGGG - Intronic
930261789 2:49155219-49155241 AGTGCTGGGCTGTCACCTCAGGG - Intergenic
935195567 2:100813067-100813089 ATTGCTGGGCTGGCACCCCAGGG + Intergenic
937423421 2:121777488-121777510 ACTGCAAGGCTGTCACCTCCTGG + Intergenic
940398713 2:153222457-153222479 GGGGCTGGGCTGTCAGCTCCTGG - Intergenic
942377467 2:175352387-175352409 AGCCCTGAGCTGTGACCTCATGG + Intergenic
943064109 2:183069208-183069230 AGGGCTGGGCTGTCAGTTCCAGG + Intergenic
948520987 2:238537701-238537723 GGTGCAGTGCTGCCACCTCAGGG + Intergenic
948522323 2:238547844-238547866 AGTGCAGTGCTCCCACCTCAGGG + Intergenic
948703301 2:239774247-239774269 AGAGCTGGGCTGTGACCCCAGGG + Intronic
1168993771 20:2116935-2116957 TGTGCTGGGCTGGCACCCCGAGG + Exonic
1171346789 20:24471182-24471204 CGTGCTAGGCTGCGACCTCAAGG + Intronic
1173961033 20:47072625-47072647 TGTGCTGGGCTCTCACCACTGGG - Intronic
1174994116 20:55546184-55546206 AGTGCAGGGGTGACACCTTAAGG + Intergenic
1175256851 20:57652849-57652871 AGAGCTGGGCTGCTCCCTCAGGG + Intronic
1175451960 20:59076871-59076893 AGTGATGTGCTGAGACCTCATGG - Intergenic
1175928183 20:62480960-62480982 AGTGCAGGGCAGTCAGCGCAGGG + Intergenic
1176018786 20:62952411-62952433 AGGGATGGGCTGGCACCTCTTGG + Intergenic
1177412972 21:20754895-20754917 AGTGATGGGATATTACCTCAGGG + Intergenic
1179315321 21:40238770-40238792 AGTACTGCACTGTCACCTCTGGG - Intronic
1179382563 21:40912792-40912814 ACTGCTGAGCTGTCACCATAAGG + Intergenic
1179621192 21:42617461-42617483 CGTGCTGGGATCTCACATCAAGG - Intergenic
1184520264 22:44989665-44989687 AGTGGTGTGATGTCAGCTCACGG + Intronic
1185008708 22:48301000-48301022 AATGCTGGGCTGGGACCACATGG + Intergenic
949889802 3:8725372-8725394 AGTCTGGGGCTGTGACCTCATGG - Intronic
950837203 3:15932085-15932107 AGTGGTGCGTTGTTACCTCAGGG - Intergenic
951607507 3:24452358-24452380 AGCCCTGGTCTGTCACCTCATGG + Intronic
953419984 3:42746993-42747015 AGAGCTGGGCAGGCACCACAAGG + Intronic
953982156 3:47418320-47418342 TGTGCTGCGCGGCCACCTCATGG - Exonic
954286090 3:49620365-49620387 AGTGCTGCGATCTCAGCTCACGG - Intronic
957781768 3:84827521-84827543 AGGGCTGGGGAGTCATCTCAAGG + Intergenic
958926578 3:100164341-100164363 ACTGCTGTTCTGTAACCTCATGG + Intronic
959369986 3:105511261-105511283 AGAGATGGTGTGTCACCTCAAGG - Intronic
959689877 3:109187432-109187454 TGTGCTGGCCTCTCACCACAGGG + Intergenic
959937784 3:112047578-112047600 AATGCTGGGCTGTTACCAGAAGG + Intronic
960960882 3:123069275-123069297 AGGACTGGGCTGTGACCTGAAGG + Intronic
965783305 3:172310715-172310737 AGTCCTGTGCTCTCCCCTCAGGG - Intronic
966187095 3:177237351-177237373 AGACCTGGCCTGTCTCCTCATGG + Intergenic
966389717 3:179439105-179439127 ATTGCTGGGCTCTACCCTCAAGG - Intronic
966712692 3:182985822-182985844 AGAGCCAGTCTGTCACCTCAAGG + Intronic
967159738 3:186725095-186725117 CGTACTGGGCTGTCACCACAGGG - Exonic
967211490 3:187174217-187174239 ACTGCTGTGGTTTCACCTCAAGG + Intronic
968548119 4:1208788-1208810 GGTGCTGGGCTTCCCCCTCATGG - Exonic
969779018 4:9381439-9381461 CGTCCTGTGCTGCCACCTCATGG - Intergenic
971389695 4:26174525-26174547 AGTGGTGCGATCTCACCTCACGG + Intronic
971758289 4:30730871-30730893 AGTGATTGGCTGACACCCCACGG - Exonic
971841787 4:31862090-31862112 AGTGGCAGGCTGTCATCTCAAGG + Intergenic
972519875 4:39843644-39843666 AGTGATGGGATGTCAGCTCACGG - Intronic
972776024 4:42241437-42241459 AGTGGTGCGCTCTCAGCTCACGG + Intergenic
974099509 4:57401469-57401491 AGTGCTGGGATGTAAACTGAAGG - Intergenic
978672379 4:111265467-111265489 ATTGCTGGGATGTCTCCCCACGG + Intergenic
979956149 4:126955916-126955938 GGGGCTGGGCTGTCAGTTCAGGG + Intergenic
981739516 4:147987486-147987508 GCTGCTGGGCTGTCGCCTGAAGG - Intronic
983968880 4:173846840-173846862 AGTGCTTGGCTTTCAACACATGG - Intergenic
986294255 5:6424114-6424136 GGTGCTGGCCTGTCACCTGTGGG - Intergenic
989105582 5:37860258-37860280 TGTACTTGGCTGTGACCTCAGGG - Intergenic
994899017 5:105745951-105745973 AGTACTGAGCTGCTACCTCATGG - Intergenic
995557429 5:113344162-113344184 AGTGCTGCCCTGTCACAGCAGGG + Intronic
996715621 5:126585429-126585451 AGAGCTTGGCTGTGAGCTCAAGG + Intronic
999654114 5:153795858-153795880 TATGCAAGGCTGTCACCTCATGG + Intronic
1000734199 5:164878894-164878916 AGTGATGGGATGTCACTTCCAGG + Intergenic
1000998427 5:167981914-167981936 AGTGGTGTGATGTCAGCTCATGG - Intronic
1002935755 6:1670957-1670979 AGAGTTTTGCTGTCACCTCATGG + Intronic
1003415929 6:5907843-5907865 AGAGCTCAGCTGTCACATCAAGG + Intergenic
1006096110 6:31657826-31657848 AGAGCTGTGATGTCACCTGAGGG + Intronic
1006245688 6:32732940-32732962 AGTTCTGGGCTTTGACCTTAGGG - Intergenic
1006976459 6:38106741-38106763 AGTAGTGAGCTGTCCCCTCAAGG - Intronic
1007621969 6:43220905-43220927 AGTGTGGGGCTCCCACCTCAGGG - Exonic
1011702680 6:89970226-89970248 AGTGCTGTCCTGCCACCTCAAGG + Intronic
1013587937 6:111596063-111596085 TTTCCTTGGCTGTCACCTCAGGG + Intronic
1014115721 6:117665700-117665722 AGTGCTGGGCTGTCTGCCTATGG + Intergenic
1015952824 6:138571220-138571242 AGTGTTGGGCTGTGACATCAAGG - Intronic
1016293492 6:142549512-142549534 ACTGCTGGGCTTTCACCTCCAGG - Intergenic
1018651018 6:165991282-165991304 AGTCCTGGGATCTCCCCTCAAGG + Intergenic
1019362753 7:613926-613948 AGTGCTGGGAGGTCCCCGCAGGG + Intronic
1019511408 7:1419444-1419466 AGTGCTGTGCTGTCAGGGCAAGG - Intergenic
1019551378 7:1604349-1604371 AGTGCTGAGCTACCACCTCCCGG + Intergenic
1019866016 7:3711319-3711341 AGTCCTGGGCTCACACTTCAGGG + Intronic
1020063101 7:5167369-5167391 AGTGCTGGGCTCTCTCCTGTTGG - Intergenic
1021840289 7:24716969-24716991 AGGGCTGGGCTGTGTCCTCTGGG - Intronic
1022099050 7:27158240-27158262 GGCGCTGGGCTGTCTCCTCCCGG + Intergenic
1024896647 7:54268687-54268709 AGTCCTGTGCTGTCACATCAAGG - Intergenic
1025829377 7:65036597-65036619 AGTGATGGGATGTCACTTCTGGG + Intergenic
1025916596 7:65871537-65871559 AGTGATGGGATGTCACTTCTGGG + Intergenic
1026195922 7:68173716-68173738 AGTCCTGGGCTGTCAGCTGGGGG - Intergenic
1026414396 7:70163114-70163136 AGTGGTGTGCAGCCACCTCATGG + Intronic
1028668685 7:93375908-93375930 AGGGCTGGGCCTTCACCTGAGGG + Intergenic
1036276457 8:7355398-7355420 CGTCCTGTGCTGCCACCTCATGG - Intergenic
1036344882 8:7954947-7954969 CGTCCTGTGCTGCCACCTCATGG + Intergenic
1036840222 8:12115714-12115736 CGTCCTGTGCTGCCACCTCATGG + Intergenic
1036862011 8:12361951-12361973 CGTCCTGTGCTGCCACCTCATGG + Intergenic
1038447196 8:27612248-27612270 AGGGCTGGGCTCTCATCCCAGGG - Intronic
1038606982 8:29016866-29016888 AGTGATGGTATGTCACTTCAAGG - Intronic
1039141192 8:34390457-34390479 AATCCTGGTCTTTCACCTCACGG + Intergenic
1041705698 8:60844149-60844171 AGTGCTGTGCTGTCTCATCTGGG - Intronic
1042327250 8:67541364-67541386 AGTGCTGGGCTGTCTGCTTGTGG - Intronic
1044299282 8:90564976-90564998 TCTGCTGTGTTGTCACCTCATGG - Intergenic
1048448155 8:134508296-134508318 AGCGCTGGGATGTCCCCTCCTGG + Intronic
1050959467 9:11708574-11708596 ACTGCTGGACTGGCACCTTAGGG + Intergenic
1051869986 9:21726571-21726593 AGTGGTGGGATCTCAGCTCATGG - Intergenic
1055986792 9:82061552-82061574 AGGGCTGGGATGCCACCCCAGGG - Intergenic
1057160387 9:92884662-92884684 AGGGCTGGGATGCGACCTCAGGG + Intergenic
1057309642 9:93933934-93933956 AGTGCAGGGGTGTCACTTCCTGG - Intergenic
1057530282 9:95839060-95839082 AGTGCTGGCCTGCCACTTGATGG + Intergenic
1059916953 9:119114585-119114607 ACTGCTTGGGTGACACCTCAAGG - Intergenic
1060500678 9:124151566-124151588 AGAGCTGGGCTGTCGCCTGTAGG + Intergenic
1061617232 9:131788211-131788233 ACTGCTGACCTGTCACTTCACGG + Intergenic
1061801303 9:133114746-133114768 CGTGCTTGGCTGTGTCCTCAAGG + Intronic
1062046217 9:134425655-134425677 AGTGGTGTGCTGTCCCCACAGGG - Intronic
1186247713 X:7631847-7631869 AGTGCTGGGCTGAGACCTGTGGG + Intergenic
1187473351 X:19588618-19588640 ACTGCTGTGCTCTCACCTCCGGG - Intronic
1189794406 X:44633739-44633761 GGTGCTCCGCTGCCACCTCAAGG + Intergenic
1193729883 X:85090090-85090112 CATGCTGGTTTGTCACCTCATGG + Intronic
1194448414 X:94013929-94013951 ATTGCTGGGCTGTACTCTCAAGG - Intergenic
1194530469 X:95042335-95042357 GGTCCTGGGCTTTCCCCTCATGG - Intergenic
1199941808 X:152635162-152635184 AGTGCTGGGCTTTCCCCCCTGGG + Intergenic
1201481470 Y:14443951-14443973 AGACCTGGGCTGACACCACAGGG + Intergenic
1202164052 Y:21968194-21968216 CGGGATGGGCTGGCACCTCATGG + Intergenic
1202227304 Y:22618170-22618192 CGGGATGGGCTGGCACCTCATGG - Intergenic
1202315818 Y:23577484-23577506 CGGGATGGGCTGGCACCTCATGG + Intergenic
1202554947 Y:26092590-26092612 CGGGATGGGCTGGCACCTCATGG - Intergenic