ID: 930265396

View in Genome Browser
Species Human (GRCh38)
Location 2:49193864-49193886
Sequence CCTACCAAACAGACTAAGAT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
930265396_930265407 29 Left 930265396 2:49193864-49193886 CCAATCTTAGTCTGTTTGGTAGG No data
Right 930265407 2:49193916-49193938 GATGAGGGTTATCAAAAGCAGGG No data
930265396_930265405 14 Left 930265396 2:49193864-49193886 CCAATCTTAGTCTGTTTGGTAGG No data
Right 930265405 2:49193901-49193923 TTAAGATCAGAGCAAGATGAGGG No data
930265396_930265403 -9 Left 930265396 2:49193864-49193886 CCAATCTTAGTCTGTTTGGTAGG No data
Right 930265403 2:49193878-49193900 TTTGGTAGGGGTGAGGGGTGAGG No data
930265396_930265404 13 Left 930265396 2:49193864-49193886 CCAATCTTAGTCTGTTTGGTAGG No data
Right 930265404 2:49193900-49193922 GTTAAGATCAGAGCAAGATGAGG No data
930265396_930265406 28 Left 930265396 2:49193864-49193886 CCAATCTTAGTCTGTTTGGTAGG No data
Right 930265406 2:49193915-49193937 AGATGAGGGTTATCAAAAGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
930265396 Original CRISPR CCTACCAAACAGACTAAGAT TGG (reversed) Intergenic
No off target data available for this crispr