ID: 930269614

View in Genome Browser
Species Human (GRCh38)
Location 2:49241022-49241044
Sequence CTTTGGTGCTGAAGGGAGAA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
930269609_930269614 27 Left 930269609 2:49240972-49240994 CCAACTTCTTTACTTGGCATGTT No data
Right 930269614 2:49241022-49241044 CTTTGGTGCTGAAGGGAGAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
930269614 Original CRISPR CTTTGGTGCTGAAGGGAGAA GGG Intergenic
No off target data available for this crispr