ID: 930272703

View in Genome Browser
Species Human (GRCh38)
Location 2:49275500-49275522
Sequence CCACAATGTTTGGCAGATCC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
930272699_930272703 28 Left 930272699 2:49275449-49275471 CCTTTAAAGCCAGGTCATGCATT No data
Right 930272703 2:49275500-49275522 CCACAATGTTTGGCAGATCCTGG No data
930272700_930272703 19 Left 930272700 2:49275458-49275480 CCAGGTCATGCATTTTATTCATC No data
Right 930272703 2:49275500-49275522 CCACAATGTTTGGCAGATCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
930272703 Original CRISPR CCACAATGTTTGGCAGATCC TGG Intergenic
No off target data available for this crispr