ID: 930277639

View in Genome Browser
Species Human (GRCh38)
Location 2:49332075-49332097
Sequence CAGTCTTATTGGCCCAAATT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
930277632_930277639 4 Left 930277632 2:49332048-49332070 CCCCAATACCACAGTAGACCTCA No data
Right 930277639 2:49332075-49332097 CAGTCTTATTGGCCCAAATTTGG No data
930277631_930277639 5 Left 930277631 2:49332047-49332069 CCCCCAATACCACAGTAGACCTC No data
Right 930277639 2:49332075-49332097 CAGTCTTATTGGCCCAAATTTGG No data
930277633_930277639 3 Left 930277633 2:49332049-49332071 CCCAATACCACAGTAGACCTCAA No data
Right 930277639 2:49332075-49332097 CAGTCTTATTGGCCCAAATTTGG No data
930277634_930277639 2 Left 930277634 2:49332050-49332072 CCAATACCACAGTAGACCTCAAC No data
Right 930277639 2:49332075-49332097 CAGTCTTATTGGCCCAAATTTGG No data
930277635_930277639 -4 Left 930277635 2:49332056-49332078 CCACAGTAGACCTCAACTCCAGT No data
Right 930277639 2:49332075-49332097 CAGTCTTATTGGCCCAAATTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
930277639 Original CRISPR CAGTCTTATTGGCCCAAATT TGG Intergenic
No off target data available for this crispr