ID: 930277958

View in Genome Browser
Species Human (GRCh38)
Location 2:49335744-49335766
Sequence CCTGCTCTGCTGGAGGAACA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
930277953_930277958 13 Left 930277953 2:49335708-49335730 CCTTTGGCAGCAGGAATGATAAG No data
Right 930277958 2:49335744-49335766 CCTGCTCTGCTGGAGGAACAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
930277958 Original CRISPR CCTGCTCTGCTGGAGGAACA GGG Intergenic
No off target data available for this crispr