ID: 930278277

View in Genome Browser
Species Human (GRCh38)
Location 2:49339268-49339290
Sequence AAAACAGACACTCATGAGAC GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
930278273_930278277 29 Left 930278273 2:49339216-49339238 CCTCTGGTTCTGAAGGCAGCTGT No data
Right 930278277 2:49339268-49339290 AAAACAGACACTCATGAGACGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
930278277 Original CRISPR AAAACAGACACTCATGAGAC GGG Intergenic
No off target data available for this crispr