ID: 930278869

View in Genome Browser
Species Human (GRCh38)
Location 2:49345798-49345820
Sequence CTGTTGTTCTTCTGGAACAA CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
930278867_930278869 -9 Left 930278867 2:49345784-49345806 CCATTTTTTCTGTACTGTTGTTC No data
Right 930278869 2:49345798-49345820 CTGTTGTTCTTCTGGAACAACGG No data
930278866_930278869 -6 Left 930278866 2:49345781-49345803 CCTCCATTTTTTCTGTACTGTTG No data
Right 930278869 2:49345798-49345820 CTGTTGTTCTTCTGGAACAACGG No data
930278865_930278869 -1 Left 930278865 2:49345776-49345798 CCTCTCCTCCATTTTTTCTGTAC No data
Right 930278869 2:49345798-49345820 CTGTTGTTCTTCTGGAACAACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
930278869 Original CRISPR CTGTTGTTCTTCTGGAACAA CGG Intergenic
No off target data available for this crispr