ID: 930280887

View in Genome Browser
Species Human (GRCh38)
Location 2:49368198-49368220
Sequence TGAGCTCTGCACATGCCAAG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
930280885_930280887 14 Left 930280885 2:49368161-49368183 CCTCATACATTGAAGTTGGGGAC No data
Right 930280887 2:49368198-49368220 TGAGCTCTGCACATGCCAAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
930280887 Original CRISPR TGAGCTCTGCACATGCCAAG AGG Intergenic
No off target data available for this crispr