ID: 930289293

View in Genome Browser
Species Human (GRCh38)
Location 2:49473018-49473040
Sequence TGCCTGGGTAAAGAGTCATG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
930289290_930289293 -2 Left 930289290 2:49472997-49473019 CCAAAAATGGGGAAAATGGGGTG No data
Right 930289293 2:49473018-49473040 TGCCTGGGTAAAGAGTCATGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
930289293 Original CRISPR TGCCTGGGTAAAGAGTCATG AGG Intergenic
No off target data available for this crispr