ID: 930295401

View in Genome Browser
Species Human (GRCh38)
Location 2:49547501-49547523
Sequence AGAGCTCTTGGCCGGTTACT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
930295401_930295408 17 Left 930295401 2:49547501-49547523 CCCAGTAACCGGCCAAGAGCTCT No data
Right 930295408 2:49547541-49547563 GTTACCTGCAGAAGATGGCAGGG No data
930295401_930295406 12 Left 930295401 2:49547501-49547523 CCCAGTAACCGGCCAAGAGCTCT No data
Right 930295406 2:49547536-49547558 GAGTAGTTACCTGCAGAAGATGG No data
930295401_930295407 16 Left 930295401 2:49547501-49547523 CCCAGTAACCGGCCAAGAGCTCT No data
Right 930295407 2:49547540-49547562 AGTTACCTGCAGAAGATGGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
930295401 Original CRISPR AGAGCTCTTGGCCGGTTACT GGG (reversed) Intergenic
No off target data available for this crispr