ID: 930295402

View in Genome Browser
Species Human (GRCh38)
Location 2:49547502-49547524
Sequence AAGAGCTCTTGGCCGGTTAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
930295402_930295407 15 Left 930295402 2:49547502-49547524 CCAGTAACCGGCCAAGAGCTCTT No data
Right 930295407 2:49547540-49547562 AGTTACCTGCAGAAGATGGCAGG No data
930295402_930295408 16 Left 930295402 2:49547502-49547524 CCAGTAACCGGCCAAGAGCTCTT No data
Right 930295408 2:49547541-49547563 GTTACCTGCAGAAGATGGCAGGG No data
930295402_930295406 11 Left 930295402 2:49547502-49547524 CCAGTAACCGGCCAAGAGCTCTT No data
Right 930295406 2:49547536-49547558 GAGTAGTTACCTGCAGAAGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
930295402 Original CRISPR AAGAGCTCTTGGCCGGTTAC TGG (reversed) Intergenic
No off target data available for this crispr