ID: 930295403

View in Genome Browser
Species Human (GRCh38)
Location 2:49547509-49547531
Sequence TTTGAGAAAGAGCTCTTGGC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
930295403_930295406 4 Left 930295403 2:49547509-49547531 CCGGCCAAGAGCTCTTTCTCAAA No data
Right 930295406 2:49547536-49547558 GAGTAGTTACCTGCAGAAGATGG No data
930295403_930295407 8 Left 930295403 2:49547509-49547531 CCGGCCAAGAGCTCTTTCTCAAA No data
Right 930295407 2:49547540-49547562 AGTTACCTGCAGAAGATGGCAGG No data
930295403_930295408 9 Left 930295403 2:49547509-49547531 CCGGCCAAGAGCTCTTTCTCAAA No data
Right 930295408 2:49547541-49547563 GTTACCTGCAGAAGATGGCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
930295403 Original CRISPR TTTGAGAAAGAGCTCTTGGC CGG (reversed) Intergenic
No off target data available for this crispr