ID: 930295405

View in Genome Browser
Species Human (GRCh38)
Location 2:49547513-49547535
Sequence TCCTTTTGAGAAAGAGCTCT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
930295405_930295410 27 Left 930295405 2:49547513-49547535 CCAAGAGCTCTTTCTCAAAAGGA No data
Right 930295410 2:49547563-49547585 GTCTTGCTCCAAAATCCTAGAGG 0: 14
1: 168
2: 192
3: 152
4: 239
930295405_930295407 4 Left 930295405 2:49547513-49547535 CCAAGAGCTCTTTCTCAAAAGGA No data
Right 930295407 2:49547540-49547562 AGTTACCTGCAGAAGATGGCAGG No data
930295405_930295408 5 Left 930295405 2:49547513-49547535 CCAAGAGCTCTTTCTCAAAAGGA No data
Right 930295408 2:49547541-49547563 GTTACCTGCAGAAGATGGCAGGG No data
930295405_930295406 0 Left 930295405 2:49547513-49547535 CCAAGAGCTCTTTCTCAAAAGGA No data
Right 930295406 2:49547536-49547558 GAGTAGTTACCTGCAGAAGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
930295405 Original CRISPR TCCTTTTGAGAAAGAGCTCT TGG (reversed) Intergenic
No off target data available for this crispr