ID: 930295407

View in Genome Browser
Species Human (GRCh38)
Location 2:49547540-49547562
Sequence AGTTACCTGCAGAAGATGGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
930295401_930295407 16 Left 930295401 2:49547501-49547523 CCCAGTAACCGGCCAAGAGCTCT No data
Right 930295407 2:49547540-49547562 AGTTACCTGCAGAAGATGGCAGG No data
930295405_930295407 4 Left 930295405 2:49547513-49547535 CCAAGAGCTCTTTCTCAAAAGGA No data
Right 930295407 2:49547540-49547562 AGTTACCTGCAGAAGATGGCAGG No data
930295402_930295407 15 Left 930295402 2:49547502-49547524 CCAGTAACCGGCCAAGAGCTCTT No data
Right 930295407 2:49547540-49547562 AGTTACCTGCAGAAGATGGCAGG No data
930295400_930295407 25 Left 930295400 2:49547492-49547514 CCATCAAAGCCCAGTAACCGGCC No data
Right 930295407 2:49547540-49547562 AGTTACCTGCAGAAGATGGCAGG No data
930295403_930295407 8 Left 930295403 2:49547509-49547531 CCGGCCAAGAGCTCTTTCTCAAA No data
Right 930295407 2:49547540-49547562 AGTTACCTGCAGAAGATGGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
930295407 Original CRISPR AGTTACCTGCAGAAGATGGC AGG Intergenic
No off target data available for this crispr