ID: 930305852

View in Genome Browser
Species Human (GRCh38)
Location 2:49673563-49673585
Sequence CAATCTTCTCCCCTTGAATT CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
930305852_930305859 12 Left 930305852 2:49673563-49673585 CCGAATTCAAGGGGAGAAGATTG No data
Right 930305859 2:49673598-49673620 ACAACAGGGGAAAGAATCTTGGG No data
930305852_930305855 -3 Left 930305852 2:49673563-49673585 CCGAATTCAAGGGGAGAAGATTG No data
Right 930305855 2:49673583-49673605 TTGTACAGGGTATGTACAACAGG No data
930305852_930305857 -1 Left 930305852 2:49673563-49673585 CCGAATTCAAGGGGAGAAGATTG No data
Right 930305857 2:49673585-49673607 GTACAGGGTATGTACAACAGGGG No data
930305852_930305856 -2 Left 930305852 2:49673563-49673585 CCGAATTCAAGGGGAGAAGATTG No data
Right 930305856 2:49673584-49673606 TGTACAGGGTATGTACAACAGGG No data
930305852_930305858 11 Left 930305852 2:49673563-49673585 CCGAATTCAAGGGGAGAAGATTG No data
Right 930305858 2:49673597-49673619 TACAACAGGGGAAAGAATCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
930305852 Original CRISPR CAATCTTCTCCCCTTGAATT CGG (reversed) Intergenic
No off target data available for this crispr