ID: 930311747

View in Genome Browser
Species Human (GRCh38)
Location 2:49750517-49750539
Sequence GCGGCTGTTTAGAGGAAGAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
930311747_930311752 18 Left 930311747 2:49750517-49750539 CCCTTCTTCCTCTAAACAGCCGC No data
Right 930311752 2:49750558-49750580 TGCTTAGAGGTCCAAGACTATGG No data
930311747_930311751 5 Left 930311747 2:49750517-49750539 CCCTTCTTCCTCTAAACAGCCGC No data
Right 930311751 2:49750545-49750567 GTCTCATTTTCTATGCTTAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
930311747 Original CRISPR GCGGCTGTTTAGAGGAAGAA GGG (reversed) Intergenic
No off target data available for this crispr