ID: 930321180 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 2:49856680-49856702 |
| Sequence | CTGTAAGCCCAGATGAAGGT AGG |
| Strand | + |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | No data | |||
| Summary | No data |
Found 1 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 930321175_930321180 | 9 | Left | 930321175 | 2:49856648-49856670 | CCAGCATTTTTGTAGAGTTGTAT | No data | ||
| Right | 930321180 | 2:49856680-49856702 | CTGTAAGCCCAGATGAAGGTAGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 930321180 | Original CRISPR | CTGTAAGCCCAGATGAAGGT AGG | Intergenic | ||
| No off target data available for this crispr | |||||