ID: 930321180

View in Genome Browser
Species Human (GRCh38)
Location 2:49856680-49856702
Sequence CTGTAAGCCCAGATGAAGGT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
930321175_930321180 9 Left 930321175 2:49856648-49856670 CCAGCATTTTTGTAGAGTTGTAT No data
Right 930321180 2:49856680-49856702 CTGTAAGCCCAGATGAAGGTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
930321180 Original CRISPR CTGTAAGCCCAGATGAAGGT AGG Intergenic
No off target data available for this crispr