ID: 930321555

View in Genome Browser
Species Human (GRCh38)
Location 2:49861018-49861040
Sequence GATCCATGGTACAGCCCTTC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
930321552_930321555 30 Left 930321552 2:49860965-49860987 CCTGTGATGAAGTTATGTAAAAA No data
Right 930321555 2:49861018-49861040 GATCCATGGTACAGCCCTTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
930321555 Original CRISPR GATCCATGGTACAGCCCTTC TGG Intergenic
No off target data available for this crispr