ID: 930321818

View in Genome Browser
Species Human (GRCh38)
Location 2:49864602-49864624
Sequence TGGCAACCTCGCTGATGCCC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
930321817_930321818 -5 Left 930321817 2:49864584-49864606 CCAAGGCATGCAGGAGCATGGCA No data
Right 930321818 2:49864602-49864624 TGGCAACCTCGCTGATGCCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
930321818 Original CRISPR TGGCAACCTCGCTGATGCCC AGG Intergenic
No off target data available for this crispr