ID: 930326212

View in Genome Browser
Species Human (GRCh38)
Location 2:49922168-49922190
Sequence GTCCAGCAGCACCACGGGTA TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 114
Summary {0: 1, 1: 1, 2: 0, 3: 13, 4: 99}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
930326212_930326218 3 Left 930326212 2:49922168-49922190 CCATACCCGTGGTGCTGCTGGAC 0: 1
1: 1
2: 0
3: 13
4: 99
Right 930326218 2:49922194-49922216 CGGATCACTTCTGCTGAGCCTGG 0: 1
1: 0
2: 0
3: 9
4: 107
930326212_930326222 29 Left 930326212 2:49922168-49922190 CCATACCCGTGGTGCTGCTGGAC 0: 1
1: 1
2: 0
3: 13
4: 99
Right 930326222 2:49922220-49922242 CGGCTCTCTGCCGCCTGCTCGGG 0: 1
1: 0
2: 2
3: 17
4: 310
930326212_930326221 28 Left 930326212 2:49922168-49922190 CCATACCCGTGGTGCTGCTGGAC 0: 1
1: 1
2: 0
3: 13
4: 99
Right 930326221 2:49922219-49922241 ACGGCTCTCTGCCGCCTGCTCGG 0: 1
1: 0
2: 0
3: 18
4: 165
930326212_930326219 9 Left 930326212 2:49922168-49922190 CCATACCCGTGGTGCTGCTGGAC 0: 1
1: 1
2: 0
3: 13
4: 99
Right 930326219 2:49922200-49922222 ACTTCTGCTGAGCCTGGATACGG 0: 1
1: 0
2: 1
3: 12
4: 136

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
930326212 Original CRISPR GTCCAGCAGCACCACGGGTA TGG (reversed) Exonic
900438532 1:2642435-2642457 GTCCAGCAGCCCCAGGGAGAGGG - Intronic
900548630 1:3242414-3242436 CTCCAGCACCACCACTGGGACGG + Intronic
902399645 1:16150950-16150972 GTCCAGCAGTACCACTGAAAGGG + Exonic
907786824 1:57620691-57620713 GGCCAGCAGCAGCAGGAGTAGGG + Intronic
913550762 1:119915374-119915396 CTCCAGCACCCCCAGGGGTAGGG + Exonic
914859446 1:151374041-151374063 GTGCAGCTGCCCCACGGGGAAGG + Intergenic
918053611 1:180998333-180998355 GACCACCACCACCGCGGGTAAGG + Intronic
919474420 1:198017032-198017054 GACCAGGAGCACCAAGGGCAGGG + Intergenic
919771071 1:201158910-201158932 ATCCAGGAGCACCAACGGTAGGG - Intronic
1062952677 10:1516362-1516384 ATCCAGCTGCACCTCGGGAAAGG - Intronic
1065539096 10:26742970-26742992 GTCCAGCAGCAGCCCGGATGGGG - Intronic
1069689845 10:70343287-70343309 GTCCAGCAGACTCATGGGTAAGG + Intronic
1071519284 10:86319102-86319124 CTCCTGCAGCACCCCAGGTATGG - Intronic
1073123562 10:101136151-101136173 GTCCAGCAGGAGCCCCGGTAGGG + Intronic
1075550969 10:123391953-123391975 GTCTGGCAGCACCACGGGACTGG + Intergenic
1076423929 10:130354020-130354042 GTCCATCAGCACCCCCGGGATGG - Intergenic
1076992827 11:284605-284627 GTCCTGCAGCACCAGGGATGCGG + Exonic
1080861787 11:36156367-36156389 GCCCAGCAGGACCCTGGGTAGGG + Intronic
1081636902 11:44727363-44727385 GTCCAGCAGCACCCCCGGGGCGG - Intronic
1082804424 11:57438517-57438539 GTCCAGCTGCTCCACGGTTGAGG - Intergenic
1083721854 11:64607420-64607442 GTCCAGCAGCACCACGGGCATGG - Exonic
1083946244 11:65924698-65924720 GTCCAGCAGCACCCAGGGCAGGG - Intergenic
1085390342 11:76179024-76179046 GTCCACCAGCCCCTCTGGTATGG + Intergenic
1087264920 11:96050126-96050148 GTCCAGGAGCCACACCGGTAAGG - Intronic
1088186446 11:107176627-107176649 GTCCCACGGCACCACGGGAAAGG + Intergenic
1096260588 12:50087723-50087745 GGCCAGCAGCACCAAGAGGAAGG - Intronic
1099989615 12:89708752-89708774 GTGCAGCTGCACCTCGGGGATGG + Exonic
1100208177 12:92374129-92374151 TTCCCCCAGCACCACTGGTAAGG + Intergenic
1113567818 13:111329249-111329271 GTCCATCATCTCCACCGGTAAGG - Intronic
1117326197 14:54671243-54671265 GCCCAGCAGCATCACTGTTAGGG + Intronic
1119968273 14:78941387-78941409 TTTGAGAAGCACCACGGGTAAGG - Intronic
1120050644 14:79861721-79861743 GTCGAGCAGCACAACAGGGATGG + Exonic
1121020249 14:90575570-90575592 GTCCTGCAGCACCAGTGGGAGGG + Intronic
1122671046 14:103372687-103372709 GGCCAGCAGCCCCACGGGGAAGG + Intergenic
1129312568 15:74722837-74722859 GCTCAGCACCACCACGGGTGTGG + Exonic
1129717306 15:77859889-77859911 GTCCAGCTGCACCAGGGGAAGGG + Intergenic
1132841325 16:1979708-1979730 GGCCAGAAGCACCGCGGGCAGGG - Exonic
1134635727 16:15790436-15790458 GCCCAGCAGCAACATGGGAAGGG - Intronic
1136358328 16:29761179-29761201 GTGCAGCAGCAGCAAGGGCATGG + Intergenic
1137352563 16:47726425-47726447 ATCCAGAGGCACCACGGGGAGGG - Intergenic
1141831084 16:86510335-86510357 ATCCAGCAGCTCCTCGGGGAGGG + Intergenic
1143593276 17:7898812-7898834 ATCCAGCAGCACCATGGGGAAGG - Intronic
1144080955 17:11763374-11763396 GTCCAACAGCACCACCAGAATGG + Intronic
1145842614 17:28008671-28008693 GGTCATCAGCACCACGTGTATGG + Intergenic
1146398753 17:32487608-32487630 GCGCAGCAGCACCATGGGCACGG + Exonic
1151477104 17:74350406-74350428 GTCCAGCTGCACAGCGGGCAGGG + Exonic
1157555195 18:48608942-48608964 GTCCACAAGCACCTGGGGTAAGG - Intronic
1160586515 18:79916269-79916291 GTACGGGAGCACCACGGGTACGG - Intronic
1160586520 18:79916286-79916308 GTACGGGAGCACCACGGGTACGG - Intronic
1160586525 18:79916303-79916325 GTACGGGAGCACCACGGGTACGG - Intronic
1166385002 19:42375916-42375938 CCCCAGCAGAGCCACGGGTACGG + Exonic
1166432807 19:42741278-42741300 CTCCTGCACCACCACGGGGAAGG - Intronic
1166435917 19:42766505-42766527 CTCCTGCACCACCACGGGGAAGG - Intronic
1166465460 19:43027267-43027289 CTCCTGCACCACCACGGGGAAGG - Intronic
1166471592 19:43083471-43083493 CTCCTGCACCACCACGGGGAAGG - Intronic
1166485210 19:43206421-43206443 CTCCTGCACCACCACGGGGAAGG - Intronic
1166492360 19:43270339-43270361 CTCCTGCACCACCACGGGGAAGG - Intergenic
1168312128 19:55465610-55465632 GGCCAGCAGCACTATGGGCAAGG + Intergenic
927939085 2:27092553-27092575 GTCCAGCAGAAACGCGGGGAGGG + Intronic
928607370 2:32955004-32955026 GTCCAGCGGGACCACTGGAAGGG + Intronic
930326212 2:49922168-49922190 GTCCAGCAGCACCACGGGTATGG - Exonic
934567345 2:95347962-95347984 GCCCAGCAGCCCCTCGGGCATGG + Intronic
941164737 2:162073406-162073428 GTTCAGCAGAACCACGGGCACGG + Exonic
943722969 2:191224160-191224182 GTCAAGCACCACCACAGGCAAGG + Intergenic
948447848 2:238046849-238046871 TTCCAGAAGCACCAAGGGTGTGG + Intronic
948454077 2:238096721-238096743 GCCCAGCAGGACCCCGGGAAGGG + Intronic
1170891376 20:20378887-20378909 GTCCACCAGCACCACTGTAAGGG - Intergenic
1172623896 20:36336665-36336687 GTCCAGCAGTCCCAGGGGCAGGG + Intronic
1173743867 20:45421488-45421510 GTCCAGCAGCAGCACCGGGAAGG - Exonic
1175355669 20:58365374-58365396 GTCAAGCACCACCATGGGCATGG - Exonic
1175759728 20:61553796-61553818 GTCCAGCAGCAACACAGCTTTGG - Intronic
1183167924 22:36161478-36161500 GTCCAGAAGCCACACAGGTATGG - Intronic
1183270343 22:36858397-36858419 ATTCAGCAGAACCACGGGCAGGG + Intergenic
1183829764 22:40411551-40411573 GCCCAGCAGCACCATGGGCCTGG - Exonic
1184816743 22:46877947-46877969 GTCCAGCACCTCCAAGGGCAGGG - Intronic
1185272582 22:49935812-49935834 GTCCAGGAGGAGCAGGGGTAGGG + Intergenic
950660903 3:14466547-14466569 GACCAGCAGCACCAGGAGCATGG - Exonic
952017138 3:28971050-28971072 GTCCAGCAGCACCAGAGCTAAGG - Intergenic
952497548 3:33929017-33929039 GTCCAGAACCACCACTGCTAAGG - Intergenic
953005213 3:38971526-38971548 GTCCAGCAGGAGCACAGATATGG - Intergenic
955821066 3:62896008-62896030 GTACAGCAGCAGCAGAGGTATGG + Intergenic
959262471 3:104099146-104099168 TTCCTGCAGGACCACGGTTAGGG - Intergenic
961370213 3:126424167-126424189 GTTCAGCAGCATAACGGGGACGG + Intronic
969324967 4:6437972-6437994 AGCCAGCAGCCCCACGGGTTTGG - Intronic
973826130 4:54709071-54709093 CTCCTGCAGCACCATGGGCAGGG + Intronic
977864900 4:102013281-102013303 TTCCAGGAGCACCAAGAGTAGGG - Intronic
981116353 4:140995298-140995320 GTACAGCAGCAGCAGAGGTACGG + Intronic
990821544 5:59846188-59846210 GTCCAGTACCACCATCGGTAAGG - Intronic
1005360197 6:25024127-25024149 GTCCCGCGGCGCCACCGGTAAGG - Intronic
1007076705 6:39072977-39072999 GCCCAGCAGCACCAGTGGGATGG + Exonic
1010022246 6:71174013-71174035 TTCCACTAGCACCATGGGTAAGG + Intergenic
1011160392 6:84382966-84382988 GTCCAGCAGCACAAAGGCTGAGG - Intergenic
1017805571 6:157942634-157942656 GTCCAGCAGCAACGCGGGGCAGG + Intronic
1020117476 7:5483919-5483941 GTCCAGCACCACCTCAGGCAGGG - Intronic
1022321206 7:29289450-29289472 GGCCAGCAGGACTACGGGTTAGG + Intronic
1026578541 7:71594883-71594905 GTCCACAAGCACCAGGGGTAAGG - Intronic
1030123516 7:106133634-106133656 GCCCAGCAGCAGCAAGGGTATGG + Intergenic
1031993772 7:128215163-128215185 GCCCAGCAACACCACTTGTAGGG - Intergenic
1035307831 7:157944713-157944735 GTCCAGCAGGTCCACGTGCATGG + Intronic
1036380889 8:8235860-8235882 CTCCCACAGCACCACGGGTCTGG + Intergenic
1037503259 8:19505672-19505694 GGCCAACAGCCCCACGGGGAAGG - Exonic
1042604013 8:70528164-70528186 GTCTAGCAGCAGCACAGGCAGGG + Intergenic
1045228420 8:100275031-100275053 GTCGAGCAGCATCACAGGTCTGG + Exonic
1049423946 8:142529018-142529040 TGCCAGCAGCACCAGGGGTGGGG - Intronic
1049483687 8:142840269-142840291 GGCCAGTAGCTCCTCGGGTAAGG - Intronic
1054798601 9:69325314-69325336 GCCCGGGAGCACCACGGGCAGGG - Intronic
1056100885 9:83299701-83299723 GTCCCGCATCACCACAGGAATGG + Intronic
1061008586 9:127942378-127942400 GTCCAGCAGCCCGGCGGGAACGG - Exonic
1062072228 9:134562473-134562495 ATCCAGCAGCTCCACTGGTAGGG + Intergenic
1062514859 9:136927682-136927704 TTCCACCAGCACCAGGGGGAGGG + Intronic
1187372807 X:18724790-18724812 GGCCAGCAACCCCTCGGGTAGGG + Intronic
1192395267 X:70774168-70774190 GCCCAGCAGCACCAGGGCTCGGG + Intronic
1193221726 X:78934712-78934734 TTCCAGCAGCACCACAGCTCTGG - Intergenic
1194981985 X:100450389-100450411 GGCTAGCAGCAGCAGGGGTAAGG - Intergenic