ID: 930327439

View in Genome Browser
Species Human (GRCh38)
Location 2:49937617-49937639
Sequence CCCGCACCTGAATGATGAGC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 135
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 127}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
930327434_930327439 -10 Left 930327434 2:49937604-49937626 CCAGCTGCCCCATCCCGCACCTG 0: 1
1: 0
2: 2
3: 40
4: 525
Right 930327439 2:49937617-49937639 CCCGCACCTGAATGATGAGCTGG 0: 1
1: 0
2: 0
3: 7
4: 127
930327432_930327439 15 Left 930327432 2:49937579-49937601 CCAGCTAGCACATCAGTTTCCAA 0: 1
1: 0
2: 1
3: 10
4: 122
Right 930327439 2:49937617-49937639 CCCGCACCTGAATGATGAGCTGG 0: 1
1: 0
2: 0
3: 7
4: 127
930327431_930327439 16 Left 930327431 2:49937578-49937600 CCCAGCTAGCACATCAGTTTCCA 0: 1
1: 0
2: 0
3: 3
4: 135
Right 930327439 2:49937617-49937639 CCCGCACCTGAATGATGAGCTGG 0: 1
1: 0
2: 0
3: 7
4: 127
930327433_930327439 -4 Left 930327433 2:49937598-49937620 CCAACTCCAGCTGCCCCATCCCG 0: 1
1: 0
2: 1
3: 48
4: 419
Right 930327439 2:49937617-49937639 CCCGCACCTGAATGATGAGCTGG 0: 1
1: 0
2: 0
3: 7
4: 127

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
930327439 Original CRISPR CCCGCACCTGAATGATGAGC TGG Intronic
903432728 1:23319888-23319910 CCAGCACCTGAAGGATGAAGAGG - Intronic
905490357 1:38338591-38338613 CTGGCACCTGAGTGATGAGATGG - Intergenic
912382766 1:109256146-109256168 CCCGCACCAGGATGCTCAGCTGG - Intronic
913339502 1:117744644-117744666 CCTGCTCCTGAATGATCAGTGGG - Intergenic
915605292 1:156946655-156946677 GACGCACCTGCATGAAGAGCTGG + Exonic
918092270 1:181307836-181307858 CCCTCACCTGAATTAAAAGCCGG - Intergenic
918452526 1:184673362-184673384 CCCGCACCTGATGAATCAGCTGG + Intergenic
1063260777 10:4386698-4386720 CCAGCCGCTGAATGATGAGTGGG + Intergenic
1065907915 10:30275017-30275039 CCTGCTCCTGAATGATGACTGGG + Intergenic
1067546675 10:47196890-47196912 CCAGCACCGGTATGATGAGCTGG + Intergenic
1068985749 10:63106306-63106328 CCCGCACTTGATGGATCAGCTGG + Intergenic
1075260313 10:120957980-120958002 CCTGCACCTGAATGATGCTAAGG + Intergenic
1075287730 10:121201747-121201769 CTGAGACCTGAATGATGAGCAGG - Intergenic
1076665350 10:132086116-132086138 CCTGCTCCTGAATGATCACCGGG - Intergenic
1076701839 10:132277338-132277360 CCCGCACAGGAATGGTGGGCTGG - Intronic
1078200576 11:9178977-9178999 CCCGGATCTGAATGTTTAGCTGG + Exonic
1080562496 11:33476711-33476733 CTGAGACCTGAATGATGAGCAGG - Intergenic
1082285624 11:50314921-50314943 CCCGCTCCTGAATGACTAGTGGG - Intergenic
1086544259 11:87949648-87949670 CCTGCTCCTGAATGATTAGTGGG - Intergenic
1089389729 11:118092510-118092532 CCTGCACCTGACGGATCAGCTGG - Intronic
1090232041 11:125114325-125114347 CCCGGCCCAGTATGATGAGCTGG + Intergenic
1094625420 12:32119064-32119086 CCCAGACCTGAATGATGACAAGG + Intronic
1096888350 12:54741236-54741258 CCTGCTCCTGAATGATCATCAGG - Intergenic
1104601509 12:130156978-130157000 CCCGCACCACAGTGATGATCTGG - Intergenic
1104786444 12:131452718-131452740 CCTGCACATGAATCAGGAGCTGG + Intergenic
1106459981 13:29960105-29960127 CCTGCACCTGATGGATCAGCCGG - Intergenic
1111190090 13:84795615-84795637 CCTGCACTTGATGGATGAGCTGG + Intergenic
1112335283 13:98510160-98510182 CCAGCACCAGAATGATGGCCAGG + Intronic
1118743782 14:68759658-68759680 CCTGCAACTGAAGGATCAGCAGG - Intergenic
1120174410 14:81277915-81277937 CCTGCAGCTGTATTATGAGCAGG - Exonic
1121580373 14:95025467-95025489 TCGGGACCTGAAAGATGAGCAGG + Intergenic
1121857874 14:97286916-97286938 CCAGTACCTGGATGATGAGAAGG - Intergenic
1127766158 15:62187216-62187238 CTGGCACCTGACTGAAGAGCTGG + Intergenic
1129966717 15:79742799-79742821 CCCGGGCCTGGAAGATGAGCAGG - Intergenic
1132320021 15:100919112-100919134 CCCGAACCTGAAGGAGGACCCGG + Intergenic
1135971302 16:27073919-27073941 CCCGCTCCTGAATTATTAACTGG + Intergenic
1138428256 16:56950900-56950922 GTGACACCTGAATGATGAGCTGG + Intergenic
1139375622 16:66494740-66494762 CCCGCTCCTGGATGGAGAGCAGG - Intronic
1141998351 16:87648877-87648899 CCAGCACCTGCATGCTGACCTGG + Intronic
1143592444 17:7893789-7893811 CCTGGACCTGAATGAGGAGTCGG - Exonic
1144088805 17:11834920-11834942 CCAGCCCCTGAGGGATGAGCAGG - Intronic
1151759714 17:76093660-76093682 CCCGCAGCTCGATGATGTGCTGG - Intronic
1157302429 18:46488706-46488728 CCCTGACCTGAAGGCTGAGCTGG - Intronic
1157863556 18:51162085-51162107 CTCCCACCTGGATGAAGAGCTGG - Intergenic
1158572509 18:58609054-58609076 CCTGCACCTGCACCATGAGCAGG + Intronic
1159584573 18:70271588-70271610 CCTGCACCTGATGGATCAGCTGG + Intergenic
1165826169 19:38707041-38707063 CCCGCACAGGAATGAAGAGCAGG + Intronic
1165944029 19:39430714-39430736 CCCGCACCTAAATGCTCAGGGGG - Intergenic
925204245 2:1992907-1992929 CCTGCACCTGATGGATCAGCTGG + Intronic
929332824 2:40704594-40704616 CCAGAACCTGCATTATGAGCCGG - Intergenic
930327439 2:49937617-49937639 CCCGCACCTGAATGATGAGCTGG + Intronic
937908112 2:127062170-127062192 CCAGAACCTCAATGATGTGCTGG - Exonic
941422399 2:165298981-165299003 CGTGCATCTGAATGATGAGATGG + Intronic
942625968 2:177901185-177901207 CCCGTACCTGATGGATCAGCTGG + Intronic
943758937 2:191587776-191587798 CCTGCACTTGAAGGATCAGCTGG + Intergenic
946391953 2:219421438-219421460 CCGGCACCTCAAGGATGAGATGG + Exonic
1168862592 20:1056505-1056527 CCAGCACCAGAACGATGGGCAGG - Intergenic
1171266510 20:23776042-23776064 CACACACCTCAATGATGAGTGGG - Intergenic
1173557667 20:43978118-43978140 ACAGCAGCTGAATGATGAGCAGG - Intronic
1174082762 20:47982884-47982906 CCGGCAACTGCATGATGTGCGGG + Intergenic
1174133194 20:48360098-48360120 CCTGCAACTGCATGATGTGCGGG - Intergenic
1176660031 21:9625454-9625476 CCCTCACCTGCAGGCTGAGCAGG + Intergenic
1177530441 21:22351989-22352011 CCAGCACTTGATGGATGAGCTGG - Intergenic
1178038181 21:28608790-28608812 CCCCCACTTTAATGATGACCTGG + Intergenic
1180062198 21:45391111-45391133 CCGGCACCTGAAGGCAGAGCAGG + Intergenic
1181000626 22:19986423-19986445 CCCCCACCTCAATGCTGAGAGGG + Intronic
1181504825 22:23346093-23346115 CTCCCACCTGACTGCTGAGCTGG - Intergenic
1181655936 22:24298695-24298717 CTCCCACCTGACTGCTGAGCTGG - Intronic
1181709813 22:24676337-24676359 CTCCCACCTGACTGCTGAGCTGG - Intergenic
1182661679 22:31929504-31929526 CAGGCACCTGAATGAGGAGGAGG + Intergenic
1183069640 22:35387161-35387183 CCCTCACCTGGATGTTGAGCAGG - Exonic
1183093841 22:35540838-35540860 CCAGCAGCTGAAGGAGGAGCAGG - Intergenic
950017258 3:9762964-9762986 CCAGCACCTGGAAGATGAGGCGG + Exonic
951535259 3:23734670-23734692 CCTGGACCTGAATGTTGAGAAGG + Intergenic
955036635 3:55274412-55274434 CCCGCTCTTGAATGATGGGGAGG - Intergenic
955132829 3:56187951-56187973 CCAAGACCTGAAGGATGAGCAGG + Intronic
959161957 3:102734724-102734746 CCTGCACCTGATGGATCAGCTGG + Intergenic
960516780 3:118610705-118610727 CCTGCTCCTGAATGATGATTGGG + Intergenic
965692955 3:171377175-171377197 CCAGCTCCTCAATGATCAGCTGG + Intronic
970909842 4:21262194-21262216 CCAAGACCTGAAAGATGAGCAGG - Intronic
975790292 4:77942130-77942152 CCTGCTCCTGAATGATGATAGGG - Intronic
979753244 4:124305390-124305412 CAGGCACCTGAATAATAAGCAGG - Intergenic
981637490 4:146897538-146897560 CCCTCCCCTGCATGATCAGCAGG - Intronic
984868990 4:184310548-184310570 ACAGCCCCTGAATGAGGAGCAGG - Intergenic
985415335 4:189730952-189730974 CCCTCACCTGCAGGCTGAGCAGG - Intergenic
986659673 5:10047773-10047795 TTCCTACCTGAATGATGAGCTGG + Intergenic
987884312 5:23793943-23793965 CCCTCACCAGAATGAGGTGCTGG - Intergenic
988130442 5:27097092-27097114 CCTGCACTTGATGGATGAGCTGG - Intronic
991670775 5:69045429-69045451 CCCGCACTTGATGGATCAGCTGG - Intergenic
991951245 5:71948520-71948542 CCCGCACTTGATGGATCAGCTGG - Intergenic
991993197 5:72361822-72361844 CCAAGACCTGAATGATGAGTAGG - Intergenic
992599623 5:78385702-78385724 CCTGCTCCTGAATGATGACTGGG - Intronic
993184507 5:84600421-84600443 CTCTCAGCTGAATGAAGAGCTGG + Intergenic
995694323 5:114863086-114863108 CCTGCTCCTGAATGATCAGTGGG - Intergenic
996381282 5:122864707-122864729 CCCGCACTTGATAGATCAGCTGG - Intronic
1001912781 5:175534673-175534695 GCCACACCAGAAGGATGAGCAGG + Intergenic
1001915920 5:175559975-175559997 CCCGCACTTGATGGATCAGCTGG - Intergenic
1002592470 5:180300154-180300176 CCCTCACCTGTATCATGGGCTGG - Intergenic
1003365783 6:5473569-5473591 CCCTCTCCTGAATCAGGAGCAGG - Intronic
1005715378 6:28542568-28542590 CATCCACCTGAATCATGAGCAGG + Intergenic
1007209728 6:40183334-40183356 CCTGCTCCTGAATGATGATTGGG - Intergenic
1007290825 6:40785344-40785366 CTGGAACCTGAATGACGAGCAGG - Intergenic
1009263195 6:61522120-61522142 CCTGCTCCTGAATGATGACTGGG + Intergenic
1012259180 6:97067747-97067769 AATGCACCTGAATGATGATCAGG - Intronic
1013770044 6:113618267-113618289 GTCGCACCTGAAAGATGAGAAGG - Intergenic
1014274307 6:119369416-119369438 CCTGCACCTGATGGATCAGCTGG - Intergenic
1017967806 6:159281495-159281517 CCTGCCCCTGAGTGAGGAGCTGG - Intergenic
1024358385 7:48442648-48442670 CTCACAACTGAATGATGACCTGG + Intronic
1029509547 7:100985333-100985355 CCCGCACTTGATGGATCAGCTGG - Intronic
1030599334 7:111575162-111575184 TGTGCTCCTGAATGATGAGCAGG + Intergenic
1033509736 7:142047938-142047960 CCCACAGCTGAATGACCAGCAGG - Intronic
1033512576 7:142074238-142074260 CCCACAGCTGAATGACCAGCAGG - Intronic
1037321176 8:17644816-17644838 TCAGCACCTGGAAGATGAGCTGG + Exonic
1041150550 8:54928309-54928331 CCTGCACCTGAATGATCATTGGG + Intergenic
1041201354 8:55453846-55453868 CACGGACCTGTTTGATGAGCTGG - Intronic
1042131894 8:65595433-65595455 CCAGAACTTGAAAGATGAGCAGG - Intergenic
1042767304 8:72337619-72337641 CCCGCAGCTGCATGAGGAGGGGG - Intergenic
1043740888 8:83810326-83810348 CCTGCACTTGAAGGATCAGCTGG + Intergenic
1043809490 8:84719010-84719032 CTGGCACCTGAAGGATGAGTAGG - Intronic
1044186219 8:89254808-89254830 CACGCAACTGAATGATCAGTGGG - Intergenic
1047927273 8:129693798-129693820 CTGGGACCTGAATGATGAGCAGG - Intergenic
1049037723 8:140089731-140089753 CCCGCACTTGATAGATGAGTAGG + Intronic
1049805705 8:144537879-144537901 CCCGCACTTGGCTGGTGAGCAGG + Intronic
1049897853 9:126941-126963 CCTGCTCCTGAATGATCAGTGGG - Intronic
1050984590 9:12066394-12066416 CCCACACCTGGATGATGACTGGG - Intergenic
1059287163 9:113184285-113184307 CCCTCACCTGAATGATTCGCTGG + Exonic
1060745247 9:126126932-126126954 CCAGCAGCTGAATGGTGAGTTGG - Intergenic
1203361718 Un_KI270442v1:222307-222329 CCGGCACCTGAATGATAAGATGG + Intergenic
1203637595 Un_KI270750v1:127298-127320 CCCTCACCTGCAGGCTGAGCAGG + Intergenic
1189416796 X:40822483-40822505 CCTGCACTTGATTGATCAGCTGG + Intergenic
1191006533 X:55716198-55716220 CCCGCTCCTGTATCATAAGCTGG + Intergenic
1198025662 X:132704161-132704183 ACTGAACTTGAATGATGAGCAGG - Intronic
1198915160 X:141662529-141662551 CAGGCACCTGAATGATGGGAGGG + Intronic
1199524642 X:148779101-148779123 CCTGCTCCTGAATGATGACTGGG - Intronic
1200942339 Y:8798115-8798137 CAGGCACCTGAATGATGGGAGGG + Intergenic