ID: 930335921

View in Genome Browser
Species Human (GRCh38)
Location 2:50045525-50045547
Sequence GTCTGTGAGGGGAAGGAGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1110
Summary {0: 1, 1: 0, 2: 11, 3: 91, 4: 1007}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
930335921_930335927 15 Left 930335921 2:50045525-50045547 CCTTCCTCCTTCCCCTCACAGAC 0: 1
1: 0
2: 11
3: 91
4: 1007
Right 930335927 2:50045563-50045585 TAAGAGATGAATAAATCAACAGG 0: 1
1: 0
2: 0
3: 29
4: 438

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
930335921 Original CRISPR GTCTGTGAGGGGAAGGAGGA AGG (reversed) Intronic
900097464 1:945837-945859 GCCCGTGAGGAGAAGCAGGAAGG - Intronic
900595228 1:3477359-3477381 GTCAGTGGGGGGCAGAAGGATGG - Intronic
900619449 1:3580235-3580257 GTCTGAGAGGGGTGGGAGGAGGG + Intronic
901689285 1:10962060-10962082 GTCTGTGAGGAGGAGGAGGAAGG - Intronic
902129127 1:14243375-14243397 CTCTGGGAGGTGGAGGAGGAGGG + Intergenic
902395118 1:16128348-16128370 GTCGGTGATGGGAAGCAGGCAGG - Intronic
902535121 1:17115287-17115309 GTCTGTGAGGTGGAGGTGGGAGG - Intronic
902571436 1:17349459-17349481 GTTTGGGAGGCCAAGGAGGATGG + Intronic
902682317 1:18052077-18052099 GTGTGTTAGGGGAAGGAGTAGGG - Intergenic
902884401 1:19394227-19394249 CTTTGAGAGGGCAAGGAGGACGG - Intronic
902980511 1:20119415-20119437 GGCTGGGAAGGGAAGGAGGGAGG - Intronic
903320038 1:22537585-22537607 GTGTGTGATGGGAAGTGGGAGGG - Intergenic
903324979 1:22564264-22564286 GGCTTTGAGGGGAGGCAGGAAGG + Intronic
903545196 1:24119609-24119631 GTCTGGGGTGGGAAAGAGGAGGG - Intergenic
903807124 1:26013398-26013420 GTGTGTGAGGGGATGGACCAGGG + Intergenic
904277418 1:29393506-29393528 GGGTGGGAGGAGAAGGAGGAAGG + Intergenic
904286774 1:29458023-29458045 GAATGGGAGGGGAAGGAGGTGGG - Intergenic
904336284 1:29800437-29800459 GTCTGGGTGTGGAAGGAGAAGGG - Intergenic
904338120 1:29810968-29810990 ATGTGTGAGGCGAAGGAGGGTGG + Intergenic
904408731 1:30312034-30312056 CTCTGGGAGAGGGAGGAGGAAGG + Intergenic
904483494 1:30808438-30808460 GTCACTGTGGGGGAGGAGGAGGG + Intergenic
904773537 1:32893878-32893900 GCCGGTGAAGGGAGGGAGGAAGG - Exonic
904947976 1:34213248-34213270 TTCTGTGATGGGGAGGTGGAAGG - Intronic
904981051 1:34502085-34502107 GTGCCTGAGGGGAAGGAGAAGGG - Intergenic
905018347 1:34792618-34792640 GGCTGTGAGGGGTGGGCGGATGG - Intronic
905174251 1:36126005-36126027 GTCTAGGAGAAGAAGGAGGACGG + Intergenic
905828458 1:41045406-41045428 ATCTATGAGGGAAAGGGGGAAGG + Intronic
905888341 1:41503766-41503788 GTCAGCGATGGGAGGGAGGAGGG - Intergenic
906224099 1:44106672-44106694 GACTGGGATGGGAAGCAGGAGGG + Intergenic
906381764 1:45337002-45337024 GGCTATGAAGGGAAGGAGGGTGG - Intronic
906785350 1:48610851-48610873 GTGTGTGTGTGGAAGGAGGAGGG - Intronic
906969762 1:50499199-50499221 GAGTCTGAGGGGAAGGAGAATGG + Intronic
907354909 1:53864143-53864165 GTTGGTGAGGAGAAGGAGGCAGG - Intronic
907380421 1:54082706-54082728 GAAAGTGAGGGGAGGGAGGAAGG + Intronic
907390129 1:54152797-54152819 AACTGAGAGGGGAAGGAGGTGGG - Intronic
907449308 1:54532957-54532979 GTCTCTGGGGGGAGGGGGGAGGG + Intergenic
908127330 1:61044074-61044096 GACAGTGAGGGGACAGAGGAAGG + Intronic
908391988 1:63691600-63691622 GTCTGGGAGGCCAAGGCGGATGG + Intergenic
908665755 1:66488197-66488219 TTATTTGAGGGGAAGCAGGATGG - Intergenic
909752889 1:79185791-79185813 GTCTTAAAGGGGAAAGAGGAGGG - Intergenic
909793183 1:79701054-79701076 GCCACTGAGGGGAAGGAGAAGGG + Intergenic
909871950 1:80752153-80752175 GTCTAGGAAGGGGAGGAGGAAGG + Intergenic
909984461 1:82143584-82143606 GGCTGGGAAGGGTAGGAGGAAGG + Intergenic
910576997 1:88776216-88776238 GTCAGGGAGGGCAAGGGGGAGGG - Intronic
911153341 1:94616298-94616320 GTTGGGGAGGGGAAGAAGGAAGG + Intergenic
911307507 1:96248986-96249008 TTATGAGAGGGGAAGGATGAGGG - Intergenic
911344623 1:96681530-96681552 CTCTGTGAGGAAGAGGAGGAAGG - Intergenic
911371594 1:97001288-97001310 ATCTGTGATGGGGTGGAGGATGG + Intergenic
911509861 1:98798444-98798466 GTCTGGGAAGGGAAGAGGGAAGG - Intergenic
911684508 1:100759404-100759426 GTTTGTTATGGGAAGGAAGAAGG + Intergenic
912212739 1:107572389-107572411 GTGTGTGCGGGGGAGGTGGATGG + Exonic
912455868 1:109796864-109796886 GGCTGTGAGGGGAAGAAGCTGGG - Intergenic
912941096 1:114045575-114045597 GTTTTTGAGGAGAAGGAGGTAGG + Intergenic
912963670 1:114218211-114218233 GTCTCAGAGGGGAGGGATGAAGG - Intergenic
913174585 1:116262346-116262368 ATCTGTAAGGTGAAGGAGGCTGG + Intergenic
913520957 1:119645945-119645967 TCCTGTGAAGGGAAGGAGAAAGG - Intronic
914256175 1:145962379-145962401 GCCTGGGAGGGGAAAGAGCAAGG - Intronic
914931202 1:151935331-151935353 AGCTGGGAGGGGAAGGAGGCAGG + Intergenic
915479150 1:156173357-156173379 GTCTGTGAAGGGAGAGAGGAAGG + Intronic
915700190 1:157784748-157784770 TTGTGTGAGGGGGAGGATGAAGG - Intergenic
916046679 1:161005282-161005304 GGGAGGGAGGGGAAGGAGGAAGG - Intronic
916243825 1:162666571-162666593 GTGTGTGGGGGAAAGGGGGAGGG + Intronic
916787262 1:168095684-168095706 ATCTGTGAGGAGGAGGAGGATGG + Intronic
917270661 1:173269907-173269929 GGCTGTGATGGGAAGAAGCAGGG + Intergenic
917964873 1:180172150-180172172 GGATGGGAAGGGAAGGAGGATGG - Intronic
918058889 1:181045526-181045548 GGCTGGGAGGGGATGCAGGAGGG - Intronic
918092516 1:181309771-181309793 CTCAGTGTGGTGAAGGAGGAAGG + Intergenic
918420631 1:184361127-184361149 TTCTGAGAGTGGAAGGTGGAAGG - Intergenic
919022811 1:192129981-192130003 GTCTGTCAGGGGAATGAGGTGGG + Intergenic
919034503 1:192289280-192289302 GGCTGGGAAGGGAAGGGGGAGGG + Intergenic
919167554 1:193915037-193915059 GGCTGTGCGGGGAATGGGGATGG - Intergenic
919433086 1:197521392-197521414 GTTTGGGAGGGGAAGGAATAAGG + Intronic
919709297 1:200710369-200710391 GCCTGTGAGGGGAAGGGGGAGGG + Intergenic
920358952 1:205398778-205398800 GACAGTGAGGGGAAGGAAGAGGG + Intronic
920453333 1:206077526-206077548 CTTTGGGAGGGGAAGGAGGGAGG + Intronic
920687544 1:208120810-208120832 GTCTGTGAGGGGAGGTCAGAGGG + Intronic
921023869 1:211259810-211259832 GGCTCTGAGGGGAGGGAGGGCGG - Intronic
921364984 1:214365129-214365151 ATCAGTGAGGGGAAGGAAGAAGG - Intronic
922228921 1:223668730-223668752 TTCTGTGATTGGATGGAGGAAGG - Intergenic
922538535 1:226401642-226401664 CTCTGAGAGGGGAATGAGGTAGG - Intronic
922780623 1:228249872-228249894 GCCTGGGAGGGGAAGTGGGAGGG - Intronic
922865007 1:228852315-228852337 GTCTTTGAGGGGGAGGAGCCTGG + Intergenic
923093614 1:230757808-230757830 GAGTGTGAGGGGATGGAGCATGG + Intronic
923202262 1:231724168-231724190 CTCTGTGTGGGGAAGGGGGCAGG + Intronic
924551463 1:245081799-245081821 TACAGTGAGGGGAAGGAGCATGG - Intronic
924632273 1:245752309-245752331 CTCTGTGAGGGCAGGGAGGGAGG - Intronic
924883452 1:248188011-248188033 CTCTCTGAGCGGAAGCAGGATGG + Intergenic
924883465 1:248188076-248188098 CTCTCTGAGCGGAAGCAGGATGG + Intergenic
924883479 1:248188142-248188164 CTCTCTGAGCGGAAGCAGGATGG + Intergenic
1062856681 10:783368-783390 GCCTGTGCCGGGAAGCAGGAGGG + Intergenic
1063077436 10:2731103-2731125 GTAGGTGAGGGGAAGGAGCATGG + Intergenic
1063482146 10:6385332-6385354 GAGTGTGAGTGGGAGGAGGAGGG - Intergenic
1064002291 10:11673718-11673740 GCGTGTGAGAGGAAGAAGGAAGG + Intergenic
1064019352 10:11796778-11796800 GTCTTTTTGGGGAAGGGGGAAGG + Intergenic
1064530428 10:16303289-16303311 GTCTGTGATGGGAAGAACAATGG + Intergenic
1064600753 10:16990057-16990079 GTGAGTGAAGGAAAGGAGGAGGG - Intronic
1065281623 10:24144865-24144887 GAATGTGAGGGGAGGGAGAAAGG - Intronic
1065433908 10:25686938-25686960 GGCTGTGAGGAGGAGGGGGAAGG - Intergenic
1065494505 10:26314884-26314906 GTCTGTGAGGAGATGAATGAAGG - Intergenic
1065668956 10:28092874-28092896 GTCTGTGATAGGAAGGTGGCTGG - Intronic
1065696854 10:28388171-28388193 GGAAGGGAGGGGAAGGAGGAAGG + Intergenic
1065702919 10:28443028-28443050 CTCTGTGAGGCCAAGGAGGGAGG + Intergenic
1066620613 10:37345290-37345312 GTCTGTGACAGGTGGGAGGAGGG - Intronic
1067570851 10:47369796-47369818 GACAGTGAGGGCATGGAGGAGGG - Intronic
1067726329 10:48773990-48774012 CTCTGTGGGGGGAAGGTGGCTGG - Intronic
1068205493 10:53845712-53845734 GGCTGAGAGGGGAAGAAAGATGG + Intronic
1068638812 10:59378755-59378777 GAGGATGAGGGGAAGGAGGAAGG - Intergenic
1069224748 10:65929017-65929039 GTGGGTGAGGGGAGGGGGGAGGG - Intronic
1069534104 10:69240579-69240601 GCCTCTGTGGGGAAGGAGGGAGG + Intronic
1069598420 10:69687560-69687582 GTCTGGGACAGGATGGAGGAGGG - Intronic
1069651551 10:70053270-70053292 TACTGAGAGGGGAAGGAGGAGGG + Intronic
1069794949 10:71046110-71046132 GTCTGTGAGTGGCAGGGAGACGG + Intergenic
1069821158 10:71229560-71229582 GGCCGTGATGGGAAGGAGGGTGG - Intronic
1070383459 10:75902385-75902407 GGGTGGGAGGGGATGGAGGAGGG + Intronic
1070463231 10:76690957-76690979 GCCTGTCATGGGGAGGAGGAGGG - Intergenic
1070976563 10:80610084-80610106 GTCTGAGATGGGAAAGAGGATGG - Intronic
1071506752 10:86237033-86237055 GTCTCTGAGGGGAAGGAGTGTGG - Intronic
1071565491 10:86669440-86669462 GTCTGTGATGGGGAGCAGCATGG + Intronic
1071798520 10:89031641-89031663 GTCAGTGAGGGGAAGAAGCAAGG + Intergenic
1071863640 10:89701700-89701722 GAATGTGTGGGGAAGGAGGTGGG + Intronic
1071946653 10:90653485-90653507 GTGTGTGAGGGGAAGCTGCAAGG - Intergenic
1072001708 10:91201581-91201603 GGCTGTGGGTGGAGGGAGGAGGG - Intronic
1072195782 10:93116262-93116284 GTCTTTGAGGGGCACAAGGAGGG - Intergenic
1072212111 10:93255781-93255803 GTCTGTGAGAAGAAGGCTGAAGG + Intergenic
1072285281 10:93908534-93908556 CTCTAGGAGGGGAAGGAGGAAGG - Intronic
1072513196 10:96149569-96149591 GCTTGTGGGAGGAAGGAGGAAGG - Intronic
1072727626 10:97824281-97824303 TTCTGTGAGGGTGTGGAGGAGGG + Intergenic
1072731712 10:97850653-97850675 GTGTGTGAGGGGAGGGAAGGCGG + Intronic
1072802781 10:98404992-98405014 GTGAGGGAGGGGAGGGAGGATGG + Intronic
1073134208 10:101211047-101211069 CTCTGTGGGGGGAAGAAAGAAGG - Intergenic
1073284832 10:102381349-102381371 GTCTGTGAGCCGAGGGAAGAAGG + Intronic
1073289154 10:102404868-102404890 GTCCGGGATGGGCAGGAGGAGGG + Intronic
1073306755 10:102508945-102508967 GTCTTTCAGGGGTAGGAGAAGGG + Intronic
1073609028 10:104925058-104925080 GCCTGTCAGGGGAAAGGGGAGGG - Intronic
1073734522 10:106330558-106330580 TTTTGGGAGGGGAAGGTGGATGG + Intergenic
1073777082 10:106798429-106798451 GTGGGTGGGGGGAGGGAGGAAGG - Intronic
1074079007 10:110152684-110152706 TTCTGAATGGGGAAGGAGGAAGG + Intergenic
1074135311 10:110620385-110620407 GTCTGTGAGTGGGAGGAAGCAGG - Intergenic
1074627721 10:115211753-115211775 GTGGGTGAGGGGAGGGGGGAGGG - Intronic
1075446786 10:122518880-122518902 GTCTTTGTGGGGAAGTAGGGAGG + Intergenic
1075710811 10:124529665-124529687 ATCCGTGAGGGGGAGGACGAGGG + Intronic
1075722464 10:124595286-124595308 GGCTGCCAGGGGGAGGAGGAGGG + Intronic
1076265112 10:129103635-129103657 GGCTGTCCTGGGAAGGAGGAAGG - Intergenic
1076652902 10:132002253-132002275 CTCTGTGTGGGCAGGGAGGATGG - Intergenic
1076729283 10:132430149-132430171 GTGTGTGAGGGAGAGCAGGAAGG + Intergenic
1077068565 11:656575-656597 GTCTGTGAGGGGCTGGACCAGGG - Intronic
1077069797 11:663717-663739 GTCGCTGAGGAGATGGAGGAAGG - Intronic
1077430180 11:2512431-2512453 GTGTGTGGGGGCAAGGATGAGGG - Intronic
1077533146 11:3106663-3106685 GTGAGTGACGGGAGGGAGGATGG - Intronic
1078064831 11:8071645-8071667 GTCTGTCAGAGCCAGGAGGATGG + Intronic
1078148715 11:8740808-8740830 GTCACTGAGTGGCAGGAGGATGG - Intronic
1078318060 11:10308109-10308131 GTCTGGGGGGTGTAGGAGGACGG - Intergenic
1079090561 11:17477136-17477158 GTCTGGGTGGGAAAGGAGGGTGG + Intergenic
1079307774 11:19338895-19338917 GGCTGTGGTGGGGAGGAGGAAGG - Intergenic
1079364190 11:19794752-19794774 TTATGTGAGGGAAAGGAGGTTGG - Intronic
1080434058 11:32223637-32223659 GTCAGTGCTGGGAATGAGGAGGG - Intergenic
1080666047 11:34337261-34337283 GGCTGTGTAGGGAAGGAGGCAGG + Intronic
1081497700 11:43632005-43632027 GTGAGGGAGGGGGAGGAGGAGGG + Intronic
1081623763 11:44634722-44634744 GGGAGGGAGGGGAAGGAGGAGGG - Intergenic
1081655227 11:44852798-44852820 GTTTGTCAGGGGAAGGGGAAAGG + Intronic
1081956192 11:47096347-47096369 GCCTGGGAGGGAAAGGAGCAGGG - Intronic
1082314515 11:50700445-50700467 TGGTGTGAGGGGAAGGGGGAGGG + Intergenic
1083048011 11:59754066-59754088 ATGTGTTAGGGGAAGGAGGTGGG + Intronic
1083213486 11:61204001-61204023 GTCTAAGAGAGGAAGAAGGAAGG - Intronic
1083216368 11:61222837-61222859 GTCTAAGAGAGGAAGAAGGAAGG - Intronic
1083219250 11:61241663-61241685 GTCTAAGAGAGGAAGAAGGAAGG - Intronic
1083441409 11:62678956-62678978 GTGTGTGACGAGAAGGAGGGCGG + Exonic
1083641518 11:64148260-64148282 GGCTGTGAGGGAAAGGGGGCGGG - Intronic
1083674743 11:64319057-64319079 GTTTGGGAGGAGAAGGGGGAAGG - Intronic
1083804523 11:65066120-65066142 TTCTGTGAGGGGTCGGGGGAGGG + Intergenic
1083887741 11:65581081-65581103 CTTTGTGAGGAGGAGGAGGAAGG + Exonic
1084149112 11:67279915-67279937 GTGTGGGAGAGGAAGGGGGAGGG + Intronic
1084546086 11:69815834-69815856 GCCTAGGAGGGGAAGGGGGATGG - Intronic
1084589782 11:70084032-70084054 GTCTGCAAAGGCAAGGAGGAGGG + Intronic
1084750754 11:71203157-71203179 ATCTGTGAGGGGGAGGCGCAGGG + Intronic
1084815553 11:71643945-71643967 GTGCATGAGGGGATGGAGGATGG - Intergenic
1084857027 11:71995987-71996009 GGCTGTGAGGAGGAAGAGGAGGG + Intronic
1084867976 11:72075418-72075440 GCCTTTGAGGGGCAGGAGGCTGG - Intronic
1084918418 11:72449259-72449281 ATCTGTGAGGAGAAGCGGGAGGG + Intergenic
1084923926 11:72496275-72496297 GGCTGGGAAGGGAAGGGGGAAGG + Intergenic
1085038722 11:73314521-73314543 GTCTGTGAGGCTCAGAAGGAGGG + Intronic
1085095961 11:73760858-73760880 GGCTGGGAAGGGAAGGAGGGCGG + Exonic
1085697134 11:78714677-78714699 GGATGGGAGGGGAGGGAGGATGG - Intronic
1085745163 11:79108919-79108941 GTTTGTGTGGGGAATGGGGAAGG - Intronic
1086198892 11:84176152-84176174 GTCTGCTAGGGGGAGGGGGATGG - Intronic
1086734078 11:90283872-90283894 GTGGGTGAGGGGATGGAGGAAGG + Intergenic
1086778473 11:90870992-90871014 GTGTGTTAGGGGTATGAGGAGGG + Intergenic
1087189840 11:95241960-95241982 AGCTGGGAGGGGTAGGAGGAGGG + Intergenic
1087975719 11:104544055-104544077 GACAGTGAAGGGTAGGAGGAGGG + Intergenic
1088571303 11:111226394-111226416 GGCTGGGAAGGGTAGGAGGAAGG + Intergenic
1088595854 11:111439621-111439643 GTCTGGGAGGGGAAGTACGAGGG - Intronic
1088885361 11:114001682-114001704 GCCTGTGAGGGAAATGGGGAGGG - Intergenic
1089078362 11:115757073-115757095 GGCTGTGATGGGAATGTGGATGG + Intergenic
1089113865 11:116078360-116078382 GGCAGGGAAGGGAAGGAGGAAGG + Intergenic
1089500862 11:118930380-118930402 GTGTGGGTGGGGAAAGAGGAGGG + Intronic
1089612069 11:119674930-119674952 ATCAGAGAGGGGCAGGAGGAAGG - Intronic
1089612281 11:119676233-119676255 GCCTTTGAGGGTCAGGAGGAAGG - Intronic
1089986071 11:122815340-122815362 GACTGAGAGGGGATAGAGGAAGG + Intergenic
1090384003 11:126346001-126346023 GGATGGCAGGGGAAGGAGGAGGG - Intergenic
1090551255 11:127822286-127822308 GACTGGGAGGGGAAGAAGGAAGG + Intergenic
1091011399 11:132004138-132004160 GTGTGTCAGGGGAATGAGGGGGG + Intronic
1091274859 11:134343074-134343096 CTCTGTGGTGGGGAGGAGGAGGG - Intronic
1091303270 11:134521476-134521498 GCCTGGGTGGGGAAGGTGGATGG - Intergenic
1091310824 11:134574070-134574092 GGCTGTGAGGAGCATGAGGATGG + Intergenic
1091370789 11:135056374-135056396 GCCTGGGAGGGTAAAGAGGAGGG - Intergenic
1091381520 12:64985-65007 GAATGGGATGGGAAGGAGGAAGG - Intergenic
1091572971 12:1706734-1706756 GACTGTGAGGGACACGAGGAAGG - Intronic
1091869226 12:3873356-3873378 GACAGGGAGGGGGAGGAGGAAGG - Exonic
1092255945 12:6927067-6927089 GTCAGTGAGGAGAGAGAGGAGGG - Intronic
1092427458 12:8386109-8386131 GTGCATGAGGGGATGGAGGATGG + Intergenic
1092477196 12:8829334-8829356 GCATGTGTGAGGAAGGAGGAGGG + Intronic
1092700976 12:11230528-11230550 GGCTGGGAAGGGAAGGGGGAAGG - Intergenic
1092930370 12:13309853-13309875 CTATTGGAGGGGAAGGAGGAAGG - Intergenic
1092961454 12:13600212-13600234 GAGTATGAGGGGAAAGAGGAAGG - Intronic
1095111992 12:38305779-38305801 ACCTGTGGGGGGAAGGGGGAGGG + Intergenic
1095282705 12:40374605-40374627 GTCAGTGAGTAGAAGGTGGACGG - Intergenic
1095313795 12:40733487-40733509 CTCTGGCAGGGGAAGGGGGAGGG - Intronic
1095990337 12:48029946-48029968 GGATGTGTGGGGAGGGAGGAGGG + Intergenic
1096127107 12:49128067-49128089 GTGGGTGAGGGGATGGAGGAAGG - Exonic
1096134058 12:49185119-49185141 GTTGGGGAGGGGATGGAGGAAGG - Exonic
1096145080 12:49273102-49273124 GTGGGTGAGGGGATGGAGGAAGG + Exonic
1096178940 12:49540132-49540154 GGATGTGAGGGAGAGGAGGAGGG - Intronic
1096242822 12:49968355-49968377 GAAGGGGAGGGGAAGGAGGAAGG - Intronic
1096503958 12:52081349-52081371 GCCTGTGAGGGGCAGCGGGAGGG + Intergenic
1096596856 12:52701380-52701402 GTGTGTGAGCGGGCGGAGGAGGG - Intronic
1096601956 12:52735877-52735899 GTCTGTGTGGGGCTGAAGGAAGG - Intergenic
1096638279 12:52975030-52975052 GGCTGGGAGGAGAAGGAGCAGGG + Intergenic
1096747207 12:53736876-53736898 GCCTGTGAGGTGGAAGAGGAAGG - Intergenic
1096789695 12:54037091-54037113 GATTGTGACAGGAAGGAGGAGGG - Intronic
1096792027 12:54051469-54051491 GTGAGTGAGGGGGCGGAGGAAGG - Intronic
1097085781 12:56467248-56467270 TTTTTTGAGGGGTAGGAGGATGG + Intronic
1097113014 12:56676123-56676145 GGCTGGGAGGGGGAGGGGGAGGG + Intronic
1097994816 12:65876920-65876942 GTCAGTGAGGTGCTGGAGGAGGG + Intronic
1099096490 12:78380292-78380314 TTGTGTTTGGGGAAGGAGGAAGG - Intergenic
1099954994 12:89344905-89344927 TTCTCTGCGGAGAAGGAGGATGG + Intergenic
1101172062 12:102107893-102107915 GCCTTTAAGGGGAAGGAAGAAGG + Intronic
1101260674 12:103026564-103026586 GTCTGTGAAGGGAGGGAGAGAGG + Intergenic
1101260875 12:103028336-103028358 GTCTGTGAAGGGAGGGAGAGAGG - Intergenic
1101315524 12:103625501-103625523 GTGGGTGGGGGGAAGGAGGAGGG - Intronic
1101527647 12:105546233-105546255 GTGGGTGAGGGGAATGAGGAAGG + Intergenic
1101696810 12:107134695-107134717 GTAATTGAGGGCAAGGAGGAAGG + Intergenic
1101850336 12:108396881-108396903 GGCCCTGAAGGGAAGGAGGAAGG + Intergenic
1102277916 12:111597992-111598014 GTCTGGCGGGGGAAGGAGGAAGG + Intronic
1102567342 12:113805270-113805292 GTGGGTGGGGGGAAGGAGGGGGG + Intergenic
1102763287 12:115408290-115408312 GTTTCTGAGGGGAAGGTGGAAGG + Intergenic
1102831416 12:116004693-116004715 GTCATTGAGAGGAAGGGGGAGGG - Intronic
1102983679 12:117262263-117262285 GTCTCTGGGGGGAAAGGGGAGGG - Intronic
1103147965 12:118611586-118611608 GCCGGGGAGGGGAAGGAGGGAGG + Intergenic
1103343008 12:120231024-120231046 GGCTGTGAAGAGGAGGAGGATGG + Intronic
1103576054 12:121878012-121878034 GGCTCTGCGGGGAGGGAGGAAGG + Intergenic
1103617315 12:122162520-122162542 GCCTGGGAGGGAAAAGAGGAGGG - Intergenic
1103946747 12:124531475-124531497 GCCTGTGGGGAGAAGGAGGGAGG + Intronic
1104433331 12:128734580-128734602 ATCAGTGAGGGGAAGGGAGAAGG + Intergenic
1104503641 12:129310198-129310220 GGCTGTGAGGGCAAGGAGGGTGG + Intronic
1104545995 12:129713464-129713486 GTGTGTTTTGGGAAGGAGGAGGG + Intronic
1104754484 12:131260498-131260520 GGCTGGGAGGGGCATGAGGATGG + Intergenic
1104965695 12:132507980-132508002 GGATGGGAGGGGAAGGACGATGG - Intronic
1106229930 13:27813956-27813978 GTGTGTCAGGGGCAGGAGGGTGG - Intergenic
1106421583 13:29590013-29590035 GTCTGTTAGGCCAAGTAGGAAGG - Intronic
1106463851 13:29995510-29995532 GTGTGTGAGGGGCAGGAGGTGGG + Intergenic
1106463956 13:29996280-29996302 ATATGTGAGGGGTAGGAGGTGGG - Intergenic
1107451923 13:40517470-40517492 GCAGGTGAGGGGAAGGAGCAAGG + Intergenic
1107543851 13:41418266-41418288 GGCTGGGAGGGTAGGGAGGAGGG + Intergenic
1107733497 13:43371940-43371962 GACTGTGTGGGCAAGGAGAACGG + Intronic
1108085960 13:46794140-46794162 TTTTTGGAGGGGAAGGAGGAAGG - Intronic
1108212492 13:48152328-48152350 GGGTGTGAGGGGATGCAGGAGGG + Intergenic
1108483509 13:50900762-50900784 GTCTGTGAGAAAAAAGAGGAGGG - Intergenic
1108488107 13:50948537-50948559 GTCTTTGAGGGGCAGAAGAAGGG + Intronic
1109162939 13:58998969-58998991 ATATGTGAAGGGAAAGAGGAGGG + Intergenic
1109233920 13:59792526-59792548 GTCGGTGATGGGAAGTAGAAGGG - Intronic
1109376446 13:61500439-61500461 CTCTGTGAGAGGTAGGAGGATGG - Intergenic
1109400922 13:61827853-61827875 GTGGGTGGGGGGAGGGAGGAGGG - Intergenic
1110012090 13:70349414-70349436 GACTGTGAAGGAAGGGAGGAAGG + Intergenic
1111506151 13:89191581-89191603 GTCTGTGAAGGATAAGAGGAAGG + Intergenic
1111598521 13:90441991-90442013 GTGTGAAAGGAGAAGGAGGAGGG - Intergenic
1111656612 13:91162022-91162044 GTAATTGAGGGGAAGGATGAGGG + Intergenic
1111832810 13:93351424-93351446 GTCTGGGAAGGGTAGGGGGAAGG + Intronic
1111996919 13:95174660-95174682 GTCGCCGCGGGGAAGGAGGAAGG - Intronic
1113371448 13:109728907-109728929 GTCTGTGAGGAGAGGGAGGCAGG + Intergenic
1113614569 13:111671304-111671326 GTCTGCGGTGGGAAGGAGGGCGG + Intronic
1113620037 13:111756218-111756240 GTCTGCGGTGGGAAGGAGGGCGG + Intergenic
1113882319 13:113634192-113634214 GGCTGTCAGGGGAGGGAGCATGG + Intronic
1114288494 14:21268890-21268912 GTGGGGGAGGGGAAGGGGGAAGG - Intronic
1114654863 14:24310064-24310086 GTTGGTGATGGGAAGGAGCAGGG + Intronic
1114879806 14:26770114-26770136 GAGTGGGAAGGGAAGGAGGAGGG + Intergenic
1115496864 14:34013509-34013531 CTCAGTGTGGGGAAAGAGGACGG - Intronic
1115754770 14:36519830-36519852 GGAGGGGAGGGGAAGGAGGAGGG + Intronic
1116634993 14:47383196-47383218 GCCTGTCAGGGGATGGGGGAGGG + Intronic
1118102756 14:62624936-62624958 GTGTGTGAAAGGAAAGAGGAGGG - Intergenic
1118309151 14:64680055-64680077 CTCTGGGAGGGGAAGAAGAAAGG - Intergenic
1118348225 14:64955228-64955250 GTGTGGGCGGGGAGGGAGGAAGG - Intronic
1118894766 14:69936536-69936558 CAGTGGGAGGGGAAGGAGGAAGG - Intronic
1118915374 14:70098484-70098506 GTCTGCGAGGGAAAGGAAGAGGG + Intronic
1119535826 14:75401718-75401740 GTGTGTCAAGGGAAGGAAGAGGG + Intergenic
1120170116 14:81239674-81239696 GGCTGGGAAGGGTAGGAGGAAGG - Intergenic
1120513037 14:85438482-85438504 GTGTCTGAGAAGAAGGAGGAGGG + Intergenic
1121140099 14:91534084-91534106 GCCTGTCAGAGGATGGAGGATGG - Intergenic
1121273390 14:92652192-92652214 GTCTGGGAGGGGCAGTGGGAAGG - Exonic
1121970081 14:98347929-98347951 GTCTGTGAGGAGCAGAGGGAAGG - Intergenic
1122066934 14:99180356-99180378 GTCTGAGAAAGGAAGAAGGATGG - Intronic
1122067853 14:99185946-99185968 ATCTGTGAAGGAAGGGAGGAAGG - Intronic
1122647936 14:103207392-103207414 GAAGGGGAGGGGAAGGAGGAAGG - Intergenic
1122672047 14:103379848-103379870 CTTGGTGAGGGGAAAGAGGAGGG - Intergenic
1123113057 14:105882019-105882041 CTCTGGGAGGAGAAGCAGGATGG - Intergenic
1123115406 14:105892169-105892191 CTCTGGGAGGAGAAGCAGGATGG - Intergenic
1123119657 14:105910887-105910909 CTCTGGGAGGAGAAGCAGGATGG - Intergenic
1123132085 14:105995513-105995535 GACTGTGTGGTGAAGGAGGTTGG - Intergenic
1123148947 14:106163145-106163167 GTGTGAGAGAGGAGGGAGGAAGG + Intergenic
1202892116 14_KI270722v1_random:168412-168434 GTCTGTGAGGGAGCTGAGGATGG - Intergenic
1124348588 15:28939020-28939042 GGCTGGGAGGGGCTGGAGGAAGG - Intronic
1124365745 15:29070363-29070385 GCCTGTGAATGGGAGGAGGAAGG - Intronic
1124369954 15:29098937-29098959 GTATGTGAGGGCCTGGAGGATGG - Intronic
1124383948 15:29190582-29190604 GTATGGGAGGGGAGGAAGGAGGG + Intronic
1124460266 15:29883528-29883550 GTTTGTGTGTGGAAGGAGGTAGG - Intronic
1124589429 15:31040343-31040365 GTCTCTGGGGGGAAAGAGAAGGG + Exonic
1124704707 15:31954180-31954202 GTCTTTGAGGAGATGCAGGAGGG + Intergenic
1124794749 15:32766729-32766751 GGGTGTGAGAGGATGGAGGAGGG + Exonic
1124849824 15:33325689-33325711 GGCAGAGAGGGGAAGGGGGAAGG - Intronic
1124968747 15:34463104-34463126 CTCTCTGAGGGTGAGGAGGATGG + Intergenic
1125258733 15:37798006-37798028 CTTTGAGAGGGGAAGGAGGCTGG - Intergenic
1125397711 15:39268367-39268389 CTGGGTGAGGGGAAGGGGGAGGG + Intergenic
1125463161 15:39925281-39925303 GTGTGTGATGGGGAGCAGGAGGG - Intergenic
1125662506 15:41405235-41405257 GTCTGGGAGGCCAAGGAAGAAGG - Intergenic
1125757075 15:42071354-42071376 GTGTCTGAGGGGAAGAAGTAAGG - Intronic
1126343901 15:47673407-47673429 GTTGGAGAAGGGAAGGAGGAGGG - Intronic
1126393465 15:48185134-48185156 GTTTGTGAGGGGAAGAGGAAGGG + Intergenic
1126506824 15:49414392-49414414 GTGTGTGGGGGGAGGGAGGGGGG + Intronic
1126776438 15:52104466-52104488 GTCTGGTATGGGATGGAGGAAGG - Intergenic
1126780465 15:52135104-52135126 CCCTGTGATGGGAGGGAGGATGG + Intronic
1126951553 15:53887169-53887191 GTTTGTGTGTGGAAGGAGAAGGG + Intergenic
1126958221 15:53958946-53958968 GGCTGTGAGGGCAAGCAGGGTGG - Intergenic
1127405381 15:58638854-58638876 AACTGTCAGGGGAGGGAGGAAGG + Intronic
1128159171 15:65411815-65411837 GTCAGTGACTGGGAGGAGGAAGG + Intronic
1128257211 15:66205787-66205809 CTCTGGCAGGGGAAGGAGGTGGG - Intronic
1128308218 15:66613862-66613884 GTCTGAGTGGAGGAGGAGGAGGG + Intronic
1128454546 15:67825348-67825370 GGGGGTGAGGAGAAGGAGGAGGG - Intronic
1128509375 15:68303942-68303964 GTCTGGGAGGGGCAGGAGGGTGG + Intronic
1128515200 15:68337641-68337663 TTCTGGGAGGGGAAGCAGGGTGG + Intronic
1128683666 15:69668556-69668578 GTCTATGAGGGGAAGAAAGGAGG + Intergenic
1128740981 15:70083538-70083560 TTATCTGAGGGGAGGGAGGAGGG - Intronic
1129257519 15:74342492-74342514 GTCTGGAAAGGGGAGGAGGAAGG + Intronic
1129992042 15:79973869-79973891 GCCTGTGAGGGAAAAGAGGGAGG - Intergenic
1130144082 15:81259596-81259618 GTCTATGAGTGAAAGGATGATGG + Intronic
1130450531 15:84047067-84047089 GCCTGTCAGGGGAAGGCGGTGGG - Intergenic
1130575091 15:85085034-85085056 GTCTGTGTGGAGAATGAAGAAGG - Intronic
1131406141 15:92166542-92166564 GTGAGTGAGGGGAAGCTGGAGGG - Intronic
1131413598 15:92232192-92232214 GTCTGTGGCTGGAGGGAGGAGGG + Intergenic
1132125417 15:99219762-99219784 GTCGGTGTAGGGGAGGAGGATGG - Intronic
1132250938 15:100335016-100335038 GGCTGAGAGGCGATGGAGGATGG - Intronic
1132550959 16:553672-553694 TTCAGGGAGGGGAAGGAGGGGGG - Exonic
1132724971 16:1334471-1334493 GTCGGTGAGCAGAGGGAGGAGGG + Intronic
1132806949 16:1779283-1779305 GTCTGTGACAGGGAGGAGGCTGG - Intronic
1133000229 16:2846990-2847012 TTATGTTAGGGGAAGGAGGAGGG - Intergenic
1133324056 16:4932659-4932681 CTCTGAGAGGGTAAGGCGGACGG - Intronic
1133370790 16:5244269-5244291 GTGCATGAGGGGATGGAGGATGG - Intergenic
1133396126 16:5448970-5448992 CCCTGTGGTGGGAAGGAGGACGG - Intergenic
1133526031 16:6606513-6606535 CTCGTAGAGGGGAAGGAGGAGGG - Intronic
1133844837 16:9444082-9444104 GTGTGTGAAGGGAATGAGGAAGG - Intergenic
1134183619 16:12066366-12066388 CTCTGTGATGGGATGGAGGGTGG + Intronic
1134191562 16:12125299-12125321 AGCTGTGTGGGGAAGGCGGAAGG + Intronic
1134464847 16:14466228-14466250 GTCTCTGAGGGACAGGATGAGGG + Intronic
1134745858 16:16587726-16587748 GAGAGAGAGGGGAAGGAGGATGG + Intergenic
1134779392 16:16882014-16882036 TTCGGTGAGGGGAGGGAGGAGGG - Intergenic
1134817434 16:17217573-17217595 ATTTGAGAAGGGAAGGAGGAGGG - Intronic
1134886491 16:17797727-17797749 GACTGTGAGAAAAAGGAGGATGG - Intergenic
1134999621 16:18766016-18766038 GAGAGAGAGGGGAAGGAGGATGG - Intergenic
1135156863 16:20059974-20059996 GTCTGTGAGGGTCAGGAGTGTGG + Intronic
1135465198 16:22679069-22679091 GGCTGGGAAGGGAAGGATGATGG - Intergenic
1135542520 16:23342834-23342856 GTTTCTGATGGGGAGGAGGAGGG + Intronic
1135736452 16:24935436-24935458 TTCCCTGAGGGCAAGGAGGACGG + Intronic
1135810882 16:25585733-25585755 GTATGTGACAGCAAGGAGGAAGG - Intergenic
1135892693 16:26371685-26371707 GTGGGGGAGGGGAGGGAGGAAGG + Intergenic
1136002493 16:27305478-27305500 GTCTGTGATGGCCAAGAGGAAGG + Intergenic
1136089796 16:27910619-27910641 GTCTGTGATGGGAAGACTGAGGG - Intronic
1136157962 16:28397842-28397864 GCCTGTAGGGGGATGGAGGATGG - Intronic
1136205125 16:28717441-28717463 GCCTGTAGGGGGATGGAGGATGG + Intronic
1136229172 16:28876973-28876995 GTCAGTGAGGGGAAGGGGCCTGG - Intergenic
1136368417 16:29820639-29820661 ATCAGAGTGGGGAAGGAGGATGG + Intronic
1136681277 16:31964437-31964459 GTGTGAGAGAGGAGGGAGGAAGG - Intergenic
1136781589 16:32905949-32905971 GTGTGAGAGAGGAGGGAGGAAGG - Intergenic
1136888204 16:33947891-33947913 GTGTGAGAGAGGAGGGAGGAAGG + Intergenic
1137473101 16:48780113-48780135 GTGTGAGAGGTTAAGGAGGAGGG - Intergenic
1137936531 16:52640229-52640251 GTCTGTGAGAAGAAGGAAGAGGG + Intergenic
1138323893 16:56144758-56144780 GTTGGGGAGGCGAAGGAGGAAGG + Intergenic
1138534630 16:57653353-57653375 GGCTGTGAGGGGAGGCAGGAAGG + Intronic
1138579404 16:57930546-57930568 GAGAGAGAGGGGAAGGAGGAGGG + Intronic
1138779640 16:59767438-59767460 GTCAGTCAGGGGACGGGGGAAGG - Intergenic
1138913645 16:61435202-61435224 GTCTGTGAGAGAAAAGAGAAGGG + Intergenic
1139803602 16:69544609-69544631 GTTTCTAAGGGGAAGGAGAAAGG + Intergenic
1139812444 16:69633672-69633694 GGCTGGGAAGGGTAGGAGGAAGG + Intronic
1139814095 16:69652963-69652985 GTATGTGAGTGGTAGGAGGAAGG - Intronic
1139936085 16:70572186-70572208 CTCTGTGGGAGGAAGGAGGCAGG + Exonic
1139972615 16:70785672-70785694 CTCAGTGAGGAGGAGGAGGAGGG + Intronic
1140663084 16:77206712-77206734 GTGTGTGGGGGGAGGGAGTAGGG - Intronic
1140728917 16:77838649-77838671 GGCAGGGAGGGAAAGGAGGAGGG - Intronic
1140850040 16:78926493-78926515 GTCTTTGAGGAGGAGCAGGATGG + Intronic
1140944901 16:79758703-79758725 GAGTGTGAGAGAAAGGAGGACGG + Intergenic
1141178172 16:81734372-81734394 GAGTGTGAGGAGCAGGAGGAGGG + Intergenic
1141198657 16:81880699-81880721 GACTGTGGAGGGAATGAGGAGGG + Intronic
1141289040 16:82700722-82700744 CTTTGTGAGGGCAAAGAGGAGGG - Intronic
1141622389 16:85243353-85243375 GCCTGTGAGGGGAAGGACACGGG + Intergenic
1141693917 16:85611314-85611336 GGCTGGGAGGGGGAGGGGGAGGG - Intergenic
1141787779 16:86213235-86213257 GTCTGTGTGGTGTAGGGGGAGGG - Intergenic
1141820491 16:86442224-86442246 GTCTGGCAGGGCAGGGAGGACGG + Intergenic
1141977656 16:87528177-87528199 GTCTGTCAGGGGCCGGAGGGAGG - Intergenic
1142106895 16:88309183-88309205 ACCTCTCAGGGGAAGGAGGAAGG + Intergenic
1142234735 16:88916647-88916669 GGCTGGGTGGGGAAGGGGGATGG + Intronic
1203084244 16_KI270728v1_random:1169931-1169953 GTGTGAGAGAGGAGGGAGGAAGG - Intergenic
1203141917 16_KI270728v1_random:1772303-1772325 GGCTGCAAGGGGGAGGAGGAGGG - Intergenic
1142622160 17:1172077-1172099 GTGTGTGTGGGGAGGAAGGAAGG + Intronic
1142721229 17:1777270-1777292 GGCTTTGAGTGGAACGAGGATGG + Exonic
1143327104 17:6106593-6106615 CTCTGGGGAGGGAAGGAGGATGG + Intronic
1143523577 17:7460319-7460341 GGGTATGAGGGGTAGGAGGATGG + Exonic
1143532075 17:7511343-7511365 GTGTGGGAGTGGGAGGAGGAAGG - Intronic
1143646634 17:8234615-8234637 GCCAGAGTGGGGAAGGAGGAGGG + Exonic
1144037709 17:11382320-11382342 CTTTGGGAGGGGAAGGTGGAAGG - Intronic
1144051412 17:11500192-11500214 ATCTGTGAGGAGACTGAGGATGG - Intronic
1144641429 17:16939518-16939540 GTCAGGGAGGGAAAGGAGGAGGG - Exonic
1144873609 17:18384947-18384969 GGCTGAGAGGGAGAGGAGGATGG + Intronic
1145116472 17:20214874-20214896 GTCAGGGACGGGCAGGAGGAAGG + Intronic
1145158864 17:20560850-20560872 GGCTGAGAGGGAGAGGAGGATGG - Intergenic
1145398090 17:22511864-22511886 GTGAGTGAGGGAGAGGAGGAAGG - Intergenic
1145739361 17:27259696-27259718 GGATGGGAGGGGAAGGAGGAAGG - Intergenic
1146055936 17:29581219-29581241 GTCTCTGGGGGGAGGGAGCAGGG + Intronic
1146497777 17:33338196-33338218 TTCTGGAAGGGAAAGGAGGATGG + Intronic
1146789808 17:35744972-35744994 GTAGGTGAGGAGGAGGAGGAAGG - Exonic
1146925484 17:36742043-36742065 GTGTGTGAGAGGGAGGAAGAGGG + Intergenic
1146977852 17:37131118-37131140 GCCTGGGAAGGGAAGGAGGAGGG - Intronic
1147159994 17:38564079-38564101 GCCTGTGTGGGGAGGGAGGGTGG + Intronic
1147179492 17:38675065-38675087 GTCTGTGTGCGGAATGGGGACGG - Exonic
1147210458 17:38870027-38870049 GTTTATTAGGGGAAGGAGGGCGG + Exonic
1147256420 17:39184863-39184885 GTCTGGGGGGGGAAGCAGGGAGG + Exonic
1147734206 17:42624627-42624649 GTGTGTCAGGGGAACGAAGACGG - Intergenic
1147810119 17:43162844-43162866 GACTGTGAGGGGTACGTGGACGG - Intergenic
1147841866 17:43377539-43377561 GTCTGTGAGGGGATGGATGTGGG - Intergenic
1147976903 17:44253068-44253090 GGGGGTGAGGGGCAGGAGGATGG + Intronic
1148339490 17:46864852-46864874 GGCTGTGCGGGGAAGCAGGAGGG - Intronic
1148532456 17:48407304-48407326 GTCTATGGGGAAAAGGAGGAAGG + Intronic
1148640776 17:49185595-49185617 CTCTGCGAGGGGAGTGAGGAAGG + Intergenic
1148677202 17:49452319-49452341 TTCAGTCAGGGGAAGCAGGAAGG - Intronic
1148687940 17:49510958-49510980 GACTGTGGGGTGAAGGAGGTTGG - Intronic
1148701751 17:49591556-49591578 GGCTGTGAAGGGAAGGACAAAGG - Intergenic
1149071142 17:52544763-52544785 GTGTGTGAAAGGAAGGAGGATGG - Intergenic
1149433883 17:56617156-56617178 GACAGGGAGGTGAAGGAGGAGGG - Intergenic
1149658209 17:58321185-58321207 CTCCGTGAGGTGAAGGATGAAGG - Intronic
1149703594 17:58675623-58675645 GTCTGTCTGGGGAAGGGAGATGG - Intronic
1150441114 17:65192272-65192294 GACTGGGAAGGGAAGGGGGAAGG + Intronic
1151023641 17:70650865-70650887 GACGGTGAAGGGTAGGAGGATGG - Intergenic
1151081684 17:71336516-71336538 GGGTGTGAGGGGAAAGGGGATGG + Intergenic
1151180770 17:72325945-72325967 GTCTGTGAAAAGAAGGAGGCAGG + Intergenic
1151816618 17:76474338-76474360 GTCTGGCAGGGGTAGGAGGGAGG + Intronic
1151942203 17:77299926-77299948 CTCTGTTTGGGGTAGGAGGAGGG - Intronic
1152401193 17:80067233-80067255 GTCTCTGAGGGCAATGAGGACGG - Intronic
1152635288 17:81428331-81428353 GTCTGTGGGAGGGAGGAGGGTGG + Intronic
1152927532 17:83094235-83094257 GGCTGTGCGGGGAAGGAGATGGG - Exonic
1153110475 18:1580436-1580458 TTCTGTGATGGGCAGGAGAAAGG + Intergenic
1153460728 18:5329821-5329843 CTCTTAGATGGGAAGGAGGAAGG + Intergenic
1153747055 18:8190268-8190290 GGCTGTGTGGGGAGGGAGGCTGG - Intronic
1153835430 18:8959629-8959651 GCCTCTCAGGGGAGGGAGGATGG + Intergenic
1154002516 18:10494521-10494543 GTCAGTGTGGGGAAGGAGGATGG - Intergenic
1154117217 18:11621666-11621688 GTCTGGGAGGGCGAGGCGGATGG + Intergenic
1154139616 18:11811341-11811363 GTCTGTGAGGGGCAAGGGGCAGG - Intronic
1154440026 18:14381451-14381473 GGTTGTGAGGGGGAGGAAGAAGG + Intergenic
1154493111 18:14936400-14936422 GTTTGTGGAGGGAGGGAGGAAGG - Intergenic
1155697217 18:28697807-28697829 GCCACTGAGGGGAAGGAGAAGGG + Intergenic
1156452733 18:37275610-37275632 GCATGTGAGACGAAGGAGGAGGG - Intronic
1156733950 18:40229962-40229984 GTGGGTGGGGGGAGGGAGGAGGG - Intergenic
1156826338 18:41434443-41434465 GTGGGGGAGGGAAAGGAGGAAGG + Intergenic
1156839822 18:41598285-41598307 GGCGCTGAGGGGAAGGAGAATGG - Intergenic
1157239301 18:45994996-45995018 GGCTATCTGGGGAAGGAGGAAGG - Intronic
1157249789 18:46084812-46084834 TTCTGTCAGGGGTGGGAGGAAGG - Intronic
1157312964 18:46566186-46566208 GGGGCTGAGGGGAAGGAGGAGGG - Intronic
1157983002 18:52404079-52404101 GACTTTGAGGGGTAGGAGGTGGG + Intronic
1158281191 18:55829920-55829942 GTCTGTGGGAGAAAGGAGAACGG + Intergenic
1158404662 18:57150863-57150885 ATCTGAGTGGGGGAGGAGGAAGG - Intergenic
1158750811 18:60257971-60257993 GACAGTGGAGGGAAGGAGGAGGG + Intergenic
1159760755 18:72422731-72422753 GTCTGTGTGGGGAAGGTGTTTGG - Intergenic
1160017443 18:75155409-75155431 GTTTGAGAGGTGAAGGAGGAGGG + Intergenic
1160434186 18:78832895-78832917 GGCTGAGAAGGGAAGGAGGGAGG - Intergenic
1160788923 19:913764-913786 GGCTGGGAGGGGCAGGTGGAAGG - Intergenic
1160909695 19:1468915-1468937 GTCTGGGAGGAGCTGGAGGAGGG - Exonic
1161207136 19:3047099-3047121 GGGGGAGAGGGGAAGGAGGAGGG - Intronic
1161333550 19:3699458-3699480 GCCTGGGGGGAGAAGGAGGACGG + Intronic
1161352774 19:3803226-3803248 GGGTGTGAGGTGGAGGAGGACGG + Intergenic
1161821575 19:6533632-6533654 GAGAGGGAGGGGAAGGAGGAAGG - Intronic
1162028219 19:7906043-7906065 GTAAGGGAGGGGGAGGAGGAGGG - Intronic
1162203284 19:9036790-9036812 GTCTGTGAAGTGAAGCAGAATGG - Intergenic
1162509216 19:11107361-11107383 GCCAGAGAGAGGAAGGAGGAAGG - Intronic
1162949730 19:14063675-14063697 GTTTGGGAGGCCAAGGAGGATGG - Intergenic
1163821181 19:19497502-19497524 GGCTCTGAGGGGAAGGAGGAGGG + Intronic
1164468095 19:28505216-28505238 GTCTGTCCAGGGCAGGAGGAGGG - Intergenic
1164597506 19:29539872-29539894 GTCTGTGCTGGGAGGGAGGCAGG - Intronic
1164731028 19:30504514-30504536 GTCAGAGGGGGGCAGGAGGAGGG - Intronic
1164911052 19:32012254-32012276 GGCTGTGAGGGAAAGCAGGTGGG - Intergenic
1165078910 19:33296700-33296722 GGCTGTGAGGGGAGGGAAGCTGG - Intergenic
1165475218 19:36026492-36026514 GGCTGCGAGGGGAAGGAGGACGG - Intronic
1165576177 19:36821039-36821061 GTCAGTGGGGGGAGGGGGGAGGG - Intronic
1165847404 19:38827084-38827106 GGGAGGGAGGGGAAGGAGGAAGG + Intronic
1165959826 19:39524671-39524693 GTCTGGGAGGGGAAGGAAGCTGG + Intergenic
1166250326 19:41565197-41565219 GGCTCTGAGGGCAAGGGGGATGG - Intronic
1166547318 19:43640969-43640991 GTCTGGGCGGGGAGGGGGGAGGG - Intergenic
1166557204 19:43708415-43708437 TTTTGTGAGGGCAAGGAGGGTGG + Intergenic
1166679817 19:44759445-44759467 GACTGGGAGGGTGAGGAGGATGG - Exonic
1166695872 19:44851236-44851258 GTCTGAGAGGGGAAGGATGGGGG - Intronic
1166722592 19:45005531-45005553 GTCTGTGAGTTTAGGGAGGATGG + Intronic
1166944700 19:46389860-46389882 GAATGGGAGGGGCAGGAGGATGG - Intronic
1166997086 19:46724772-46724794 GGATGTGAGGGGAAGGCGGGAGG + Intronic
1167054997 19:47104803-47104825 GTCTGTTAGGAAAATGAGGAGGG + Intronic
1167441706 19:49512914-49512936 GTCTGAGGGAGGAGGGAGGAGGG + Intronic
1167591502 19:50406818-50406840 GTCTGGGTGGGGATGGAGGTAGG - Intronic
1167703835 19:51066496-51066518 GTGGGGGAGAGGAAGGAGGAAGG + Intergenic
1168165284 19:54543076-54543098 GTCAGTGAAGGGAAGGAGCAGGG - Intronic
1168379731 19:55909870-55909892 CTCAGTGTAGGGAAGGAGGAGGG - Intronic
1168402494 19:56093462-56093484 AACACTGAGGGGAAGGAGGACGG - Intronic
1168629213 19:57944111-57944133 ATGTGTGAGGGGAAGGATTATGG - Intronic
925013206 2:501675-501697 GCCTCTGAGGGCAGGGAGGAGGG - Intergenic
925135276 2:1522288-1522310 GACTGTGAGGGCAAGGTGGCAGG - Intronic
925135285 2:1522328-1522350 GTCTGTGAGGGCACGGTGGCAGG - Intronic
925135314 2:1522448-1522470 GTCTGTGAGGGCACGGTGGCAGG - Intronic
925153263 2:1631796-1631818 GCCTGAGAAGGGAAGGAGGTAGG - Intergenic
925200030 2:1959671-1959693 GTGTGTGAGGGGCAGAGGGATGG - Intronic
925850913 2:8081271-8081293 GCCTGTGAGAAGCAGGAGGAGGG - Intergenic
926039042 2:9658026-9658048 CTCTGTGAGCAGAAGGTGGAGGG - Intergenic
926136440 2:10339944-10339966 GTATGTGAGGGGTATGGGGAGGG + Intronic
926690402 2:15729262-15729284 GTCTGTGACTGGAAGGCAGAAGG + Intronic
926696211 2:15771515-15771537 GGCAGAGAAGGGAAGGAGGAAGG - Intergenic
926884183 2:17582221-17582243 AGGGGTGAGGGGAAGGAGGAAGG + Intronic
927078791 2:19607531-19607553 GTTGGAGAGGGGAAGGACGAAGG - Intergenic
927179424 2:20434090-20434112 GACTGTGATGGGAGGGAGGAGGG + Intergenic
927305211 2:21563380-21563402 GTCTGGGAGGGGTAGGGGGAAGG + Intergenic
927384537 2:22517962-22517984 GTCTCTCAGGGCAAGGAGAAGGG + Intergenic
927601177 2:24442901-24442923 CTTTGTGAGGGGAAGGTGGGAGG + Intergenic
927702115 2:25275412-25275434 GTGTGTGAGGGGGCGGAGGGTGG - Intronic
928427187 2:31189077-31189099 GTTTGTGAGTGGAAGGAGGGTGG + Intronic
928776107 2:34765582-34765604 GTGGGTGAGGGGAAAGAGGAGGG + Intergenic
928839063 2:35583934-35583956 CTCTGAGAGGGGAATGAGGTAGG - Intergenic
929109663 2:38396125-38396147 GTTTGTGGGGAGAGGGAGGAGGG - Intergenic
929250527 2:39749755-39749777 GTCTGTCAGGGGGAGGTGGGAGG - Intronic
929576987 2:43058075-43058097 TCCTGTGAGGGGATGGAGGGAGG + Intergenic
929748812 2:44688708-44688730 TTCTGTGTGGGGAAGGGGGAAGG - Intronic
930335921 2:50045525-50045547 GTCTGTGAGGGGAAGGAGGAAGG - Intronic
930851512 2:55965940-55965962 GTGTGTGAAGGGAAGGAGGAAGG + Intergenic
930878424 2:56245411-56245433 CTCTGCCAGGGGATGGAGGAGGG + Intronic
931668648 2:64627539-64627561 GCCTGAGAGGGGAGGGAGGGAGG + Intergenic
931890044 2:66661731-66661753 GTCAGTGTGGGGAAGTGGGATGG + Intergenic
931997020 2:67848471-67848493 GTCTGTGGGGAGAATGATGAGGG - Intergenic
932086257 2:68765028-68765050 GTCTGTGAGGGAACTCAGGAAGG - Intronic
932291758 2:70586786-70586808 GTCTGGAAGGGTAAGGGGGAAGG - Intergenic
932316777 2:70790130-70790152 GTCTGGGAGGGGACAGAGGAGGG - Intronic
932514129 2:72327296-72327318 GTCCTTGAAGGGAAGGTGGAAGG - Intronic
932883400 2:75525329-75525351 GGCTGTGAAGGGAAGTAGAATGG - Intronic
933224456 2:79729453-79729475 GTCAGTGAGAGGAAGCAGCACGG - Intronic
933894125 2:86795008-86795030 GTCTGGGAGTGGGAGGGGGAAGG - Intronic
934487373 2:94728253-94728275 GTCTTTCAGGGGAAGAAGAATGG - Intergenic
934608044 2:95713045-95713067 GTCGGTGAGGCTATGGAGGACGG - Intergenic
935037703 2:99395334-99395356 GTCTCAAAGGGAAAGGAGGAGGG - Intronic
935065180 2:99641166-99641188 CTCTGACAGGGGAAGGAGAAGGG - Intronic
935707948 2:105872561-105872583 GTCTGTGAGGTTTAGGAGGCTGG + Intronic
935829071 2:106980404-106980426 GTCTGTGTGGGGAAAGATAATGG - Intergenic
935981660 2:108634194-108634216 GTCTGTAGGGGGAGGGAAGAAGG + Intronic
935982028 2:108636804-108636826 CTCTGTGTGGGGAGAGAGGAAGG + Intronic
936541383 2:113354932-113354954 GTTGGTGAGGCTAAGGAGGATGG - Intergenic
937471258 2:122175831-122175853 GTAGGTGAGGGGAAGTAGGGAGG + Intergenic
937863856 2:126733312-126733334 TTCTGTGAGGGCAGGGAGGAGGG + Intergenic
938271893 2:129979857-129979879 GGCTGGGAAGGGAAGGAGGGCGG - Exonic
938388780 2:130887824-130887846 CACTGTGCTGGGAAGGAGGATGG + Intronic
938444108 2:131363943-131363965 GGCTGGGAAGGGAAGGAGGGCGG + Intergenic
939080477 2:137654755-137654777 TTCTGTGGGGGGCTGGAGGAAGG + Intronic
939270668 2:139935349-139935371 GTCTGTGAGGAGAGGAAAGAGGG - Intergenic
940080025 2:149790767-149790789 TGCAGTGAGGGGAAGGGGGAGGG - Intergenic
940660916 2:156544188-156544210 GTCTGTCAGCTGAAGTAGGATGG + Intronic
940843172 2:158608580-158608602 TCCTTTGAGGGGAAGGAGGAAGG + Intronic
941428631 2:165383901-165383923 GAGAGTGAGAGGAAGGAGGAAGG + Intronic
941708023 2:168680473-168680495 GTCAGTGAGCAGATGGAGGAAGG - Intronic
941924603 2:170882918-170882940 GGAGGGGAGGGGAAGGAGGAAGG + Intergenic
942023839 2:171894001-171894023 CTGGGGGAGGGGAAGGAGGAGGG - Intronic
942452193 2:176115258-176115280 GTAAGGGAGGGGAAGGAGGTGGG - Intronic
942501099 2:176591888-176591910 GACTGTGGGAGGAAGTAGGAAGG + Intergenic
943177553 2:184496506-184496528 GTCTGTTAGGGGCTGGGGGAGGG + Intergenic
943548252 2:189308249-189308271 GGCCATGATGGGAAGGAGGAAGG + Intergenic
944402599 2:199345413-199345435 GTTTGTGGGGGGAGGGGGGAGGG - Intronic
944625663 2:201566354-201566376 GCCTGTGAGGGGTGGGGGGAGGG - Intronic
944903508 2:204239795-204239817 ATCTGGGAGGGGAAGGGGTAGGG - Intergenic
944948862 2:204723719-204723741 GGCAGTGAGGGGCAGGATGATGG + Intronic
945184392 2:207124403-207124425 GTCTGCAAGAGGAAGAAGGAGGG + Exonic
945538702 2:211055143-211055165 GTTGGTGAGAGGGAGGAGGAGGG + Intergenic
946213016 2:218162578-218162600 GCCTGTGTGGGGAAGGATCAGGG - Intergenic
946366164 2:219250452-219250474 GTGGGTGAGGGCATGGAGGAGGG - Exonic
946369498 2:219272013-219272035 GTGGGTGAGGGCATGGAGGAGGG + Intronic
946878865 2:224157933-224157955 GTCTATGTGGGGAAGGACTAAGG - Intergenic
946987341 2:225287555-225287577 GTCTGTGAGGTGGAGCAGGTAGG - Intergenic
947520978 2:230845808-230845830 GGATGTGAGGGGAGGTAGGAAGG - Intergenic
947644587 2:231729078-231729100 GTCTGTGTTGGGGAGGAGAAAGG - Intergenic
947806943 2:232975649-232975671 GTCTTTGTGGGGAGGGAGGTGGG - Intronic
947919119 2:233854311-233854333 GGCTGGGAGGGGACGTAGGACGG - Intronic
948155306 2:235776719-235776741 GTGTGCAAGGGGAAGGGGGAGGG - Intronic
948234241 2:236375673-236375695 GTCTGTGAGGGCAAGAAGGCTGG - Intronic
948797418 2:240412080-240412102 CTGTGTGCGGGGAAGGAGAACGG - Intergenic
948887398 2:240891121-240891143 GTCTGTGAGAGGAAGGAGAGGGG - Intronic
948979987 2:241489253-241489275 GACTGTTAAGGGAAGGATGATGG + Intronic
1168875931 20:1172106-1172128 CTCTGTGGGGGAGAGGAGGAGGG - Intronic
1169038840 20:2476196-2476218 GTCTGTGTGGGGAAGGCCTAAGG + Intronic
1169065120 20:2690829-2690851 GTCTGAGAGCAGAAGCAGGAAGG + Intergenic
1169389302 20:5176495-5176517 GTATGAGAGAGGAAGAAGGAGGG + Intronic
1169944591 20:10975066-10975088 GTCTGTTAGTGGGAGAAGGAGGG + Intergenic
1170476976 20:16725118-16725140 GTGTGTGTTGGGCAGGAGGAGGG + Intergenic
1170566858 20:17612468-17612490 GTGTGTGAGGTGAGGGAGGCTGG - Intergenic
1170632442 20:18077082-18077104 GTCTGTGAGAGAAATGAGGAGGG + Intergenic
1170747229 20:19111071-19111093 GTGTGTGTGGGGAGGGGGGAGGG + Intergenic
1171007034 20:21476409-21476431 GTATGTCAGAGGAAGGAAGAAGG - Intergenic
1171013641 20:21521984-21522006 GGCTGGGAGGCGGAGGAGGAGGG - Intergenic
1171767221 20:29296931-29296953 GCCTGTGAGGGGAGGGGGAAGGG + Intergenic
1172565719 20:35928823-35928845 GCCCTTGAGGGGAAGGAGGAAGG + Intronic
1173278661 20:41607061-41607083 GTAGGTGAGGGGCTGGAGGAGGG - Intronic
1173824169 20:46036808-46036830 GGCTTTGTGGGGAGGGAGGATGG + Intronic
1173850787 20:46216498-46216520 GCCAGTGAGGGGTTGGAGGATGG + Intronic
1173860136 20:46277864-46277886 GGCTTTGAAGGGAAGGAGGGAGG + Intronic
1174137822 20:48392879-48392901 GGCAGGGAGGGGATGGAGGATGG + Intergenic
1174476842 20:50801820-50801842 GGGACTGAGGGGAAGGAGGATGG + Intronic
1175120208 20:56710964-56710986 GATGGGGAGGGGAAGGAGGAGGG - Intergenic
1175226063 20:57444657-57444679 GTGTGGGAGCGGAAAGAGGATGG + Intergenic
1175313992 20:58033163-58033185 GTCTGTGAGGGGGAAGCAGAGGG + Intergenic
1175320519 20:58084669-58084691 GGGTGGGAGGGGAAGGAGGAAGG - Intergenic
1176332459 21:5560794-5560816 GCCTGTGATGGAAAGGAGAAGGG - Intergenic
1176395298 21:6260157-6260179 GCCTGTGATGGAAAGGAGAAGGG + Intergenic
1176441859 21:6728947-6728969 GCCTGTGATGGAAAGGAGAAGGG - Intergenic
1176455720 21:6908320-6908342 GGTTGTGAGGGGGAGGAAGAAGG - Intergenic
1176466121 21:7056016-7056038 GCCTGTGATGGAAAGGAGAAGGG - Intronic
1176489682 21:7437794-7437816 GCCTGTGATGGAAAGGAGAAGGG - Intergenic
1176833893 21:13773368-13773390 GGTTGTGAGGGGGAGGAAGAAGG - Intergenic
1176918910 21:14662836-14662858 TTCTGTGAGGGGAATGACAAAGG - Intergenic
1177587811 21:23120771-23120793 GTCTGAGAGGAGAAGAATGATGG + Intergenic
1177758269 21:25373602-25373624 GTGGGAGAGGGGGAGGAGGAGGG - Intergenic
1177797213 21:25791618-25791640 GTCTGAGATGGGTAGGAAGAGGG + Intergenic
1178575729 21:33788270-33788292 GTGTGTGTGTGGAAGGAGGTGGG - Intronic
1179542606 21:42093460-42093482 CTTTGTGAGGCCAAGGAGGAAGG - Intronic
1179572524 21:42286367-42286389 GGCTGGAAGGCGAAGGAGGAGGG - Intronic
1179677932 21:42997302-42997324 GCCTGTGTGGGGATGGAGGTTGG + Intronic
1179818940 21:43925337-43925359 GACTGGGAGGGGCAGGAGGGTGG - Exonic
1180572554 22:16741616-16741638 GTTAGTGGGGGGCAGGAGGAGGG - Intergenic
1180924423 22:19544087-19544109 GTCTGAGAGGGCAGGGAGGTCGG - Intergenic
1180989296 22:19924821-19924843 ACATGTGAGGGGAAGAAGGAGGG + Intronic
1182123934 22:27802918-27802940 GTGTGTGTAGGGAAGGAGGGGGG + Intergenic
1182241856 22:28922650-28922672 GACTGGGAGGGGATGGAGAAGGG - Intronic
1182253165 22:29018071-29018093 GTGTGGGAGGGGAGGGCGGACGG + Intronic
1182263283 22:29091860-29091882 GTCTGTGATGGGAAGTATTAGGG + Intronic
1182738381 22:32547494-32547516 GACCATGAGGGGAAGGAGGCAGG - Intronic
1183030807 22:35103060-35103082 GACTGTGAGGGGTGGGAGGAGGG - Intergenic
1183272109 22:36868654-36868676 GGCTGTGAAGGGAGGGAGGGAGG + Intronic
1183357920 22:37369358-37369380 GGCTGTCAGGGGAGCGAGGAGGG - Exonic
1183404723 22:37624856-37624878 GTGTGTGAGGGGAAGGGAAAGGG - Intronic
1183779542 22:39989914-39989936 GTCTGCCGGAGGAAGGAGGAGGG + Intergenic
1184072124 22:42152853-42152875 GTCTGTGGGCGGGAGGAAGAGGG - Intergenic
1184570161 22:45317938-45317960 GTCTGTGAGGGGCTGTAGAAGGG + Intronic
1184777084 22:46628635-46628657 GTGTCTGAGGGGCAGGTGGAGGG + Intronic
1185224313 22:49644200-49644222 GTGGGTGTGGGGACGGAGGATGG + Intronic
949775328 3:7626185-7626207 TTCTGGGAGGGGAGGGACGAGGG - Intronic
949932478 3:9089699-9089721 TTCTGTTAGTAGAAGGAGGAAGG - Intronic
949933508 3:9098974-9098996 GCCTGCATGGGGAAGGAGGAGGG - Intronic
950096076 3:10331425-10331447 GTATGTGTGGGGCAGGGGGATGG + Intronic
950471809 3:13190997-13191019 GTGTGTTGGGGGCAGGAGGAGGG - Intergenic
950567947 3:13782359-13782381 CTCTGTGTGGGGAGGGAGGTCGG - Intergenic
950685882 3:14618366-14618388 GTTTGTGAGAGGTAGGGGGAAGG + Intergenic
950958640 3:17081248-17081270 GTGAGGGAGGAGAAGGAGGAGGG - Intronic
951097991 3:18654023-18654045 GGCTGGGAAGGGTAGGAGGAAGG - Intergenic
951465513 3:22996924-22996946 GTCTGTGATGGGAACATGGATGG - Intergenic
952192967 3:31043197-31043219 GTCAGGGAGGGGAGGGTGGAGGG - Intergenic
952979459 3:38723181-38723203 GTTTTTGAGGGTAAAGAGGAAGG + Intronic
953072646 3:39537296-39537318 GTCTGGGAGGCCAAGGAGGGAGG - Intergenic
953182019 3:40604770-40604792 GTATGTGGGGGGATGGAGGGAGG - Intergenic
953184438 3:40625143-40625165 GCCTGTGTGGGGAAGGTGGGAGG + Intergenic
953876520 3:46669859-46669881 GCCTGTGAGGGGAGGGTTGAGGG - Exonic
954411764 3:50374121-50374143 GGAGGTAAGGGGAAGGAGGAAGG + Intronic
954493187 3:50927225-50927247 GTCAGTGAGGGGAAGGAAGGAGG - Intronic
954861633 3:53695440-53695462 GGCTGGGCGGGGCAGGAGGAGGG - Intronic
955242057 3:57186949-57186971 GAGTGTGAGGGGAAGCAAGACGG + Intergenic
955422990 3:58758679-58758701 GTGGGTGAGGGGAAGGGGGAGGG - Intronic
955558352 3:60162101-60162123 CTCTGTGAGGAGACAGAGGAAGG + Intronic
955607363 3:60720173-60720195 TTCTGTATCGGGAAGGAGGATGG - Intronic
956206381 3:66759190-66759212 GTCTGTAAGGTAAAGGAGTAGGG + Intergenic
956325655 3:68049775-68049797 GGTGGTGAGGGGAAGGAGCAGGG + Intronic
956960925 3:74399822-74399844 GGCTGGGAAGGGCAGGAGGAAGG - Intronic
957105131 3:75877270-75877292 GTTAGTGGGGGGCAGGAGGAGGG + Intergenic
957148257 3:76452318-76452340 TTGTGTGGGGGGAAGGGGGAGGG - Intronic
957640771 3:82850346-82850368 GACAATGAGGAGAAGGAGGAGGG - Intergenic
957888310 3:86320313-86320335 GAGGGTGAAGGGAAGGAGGAGGG - Intergenic
958129183 3:89395803-89395825 GGATGGGAGGGGAAGGTGGAAGG - Intronic
958191841 3:90194048-90194070 GTCTGTGAAGGAAAGGAATATGG + Intergenic
958552470 3:95635006-95635028 GTCTGTGGAAGGAATGAGGAAGG - Intergenic
958652300 3:96952861-96952883 GTCTGTGGAGGGTGGGAGGAGGG + Intronic
958924565 3:100144137-100144159 CTCTGTGCGGGGGAGGAGTAGGG + Intronic
959496780 3:107061014-107061036 GTGTTTGAGGGTAGGGAGGAAGG + Intergenic
959574461 3:107919402-107919424 GCCTGGAAGAGGAAGGAGGAAGG + Intergenic
959682481 3:109111619-109111641 GGGTGTGAGAGAAAGGAGGAAGG + Intronic
959941155 3:112082993-112083015 CTCGGTTAGGGGATGGAGGAGGG + Intergenic
960284456 3:115811249-115811271 GTCTGAGAGGGGAAATAGGATGG + Intronic
960293169 3:115911585-115911607 CTCTGGGAGGTCAAGGAGGATGG - Intronic
961281975 3:125771282-125771304 GTGCATGAGGGGATGGAGGATGG - Intergenic
961333379 3:126155920-126155942 CTCTGTGACAGGAAAGAGGAAGG + Intronic
961425939 3:126847846-126847868 GTAAGAGAGGGGAAGGAGGACGG - Intronic
961860758 3:129915537-129915559 GTCGGTGAGGGGAAGCAGCAGGG - Intergenic
962974589 3:140434650-140434672 GCCAGTGATGGGAAGGAGCAGGG + Intronic
963225757 3:142860129-142860151 GGCTGTCAGGGGCAGGAAGAGGG - Intronic
963550097 3:146709380-146709402 GTATGGGAAGGGAGGGAGGAAGG - Intergenic
963904341 3:150762064-150762086 GACTGTGTGGGGATTGAGGAGGG - Intronic
963918450 3:150882753-150882775 GTCTGTGTGTGGCAGGAGGGAGG + Intronic
964040974 3:152261417-152261439 GTCTGGGAAGGTGAGGAGGAGGG + Intronic
964106468 3:153045578-153045600 GTCTTTCAGGGAATGGAGGAAGG + Intergenic
964148311 3:153493176-153493198 GGCTGTGAAGGGTAGAAGGAAGG + Intronic
964214321 3:154262743-154262765 GAGTGTGAGGGGAAGCAGGGCGG + Intergenic
965079513 3:164019539-164019561 GTCTTTGAGGGGAACTGGGAAGG + Intergenic
965763883 3:172109705-172109727 GACTGGGAAGGGATGGAGGAAGG - Intronic
966182521 3:177199637-177199659 GTCATTTAGGGGAAGGAGAAGGG - Intergenic
966302831 3:178497956-178497978 GTGTTGGAGGGGTAGGAGGAGGG - Intronic
966669313 3:182509179-182509201 GGCTGTGAAGGGAAAGAGAAGGG - Intergenic
966948566 3:184795653-184795675 GACAGTGAGGGGGAGGGGGAGGG - Intergenic
967423965 3:189304878-189304900 GGCTGTGAGTGGGAGGAGGCGGG - Intronic
967453101 3:189649737-189649759 GGATCTGAGGGGAATGAGGATGG + Intronic
967826625 3:193882419-193882441 GATTGTGGAGGGAAGGAGGAGGG - Intergenic
968035614 3:195544940-195544962 CTCAGCGAGGGGAAGCAGGATGG + Intergenic
968119984 3:196119384-196119406 GTCTGGGAGGCTAAGGCGGACGG - Intergenic
968276422 3:197443914-197443936 GCCTATGGGGGGAAGGAGAATGG + Intergenic
968763726 4:2457436-2457458 CTCTGTGGCAGGAAGGAGGAGGG + Intronic
969190360 4:5513303-5513325 GTCTGTGATGGGAGGCATGAAGG + Intergenic
969375513 4:6760967-6760989 GTCTGGGAGGGGTAGGAAGTGGG - Intergenic
969612510 4:8235334-8235356 GTGTGTGAGAGGAAGGAGGCTGG + Intronic
970322250 4:14886278-14886300 ACCTGTGAGGGGAAGGATGGAGG - Intergenic
970740755 4:19234959-19234981 GTGTGTGAAGGGAGGAAGGATGG - Intergenic
971218333 4:24682383-24682405 GTCTGAGAGGGGTAGCAGGGAGG - Intergenic
971523289 4:27582640-27582662 TGGTGTGAGGGGATGGAGGAGGG + Intergenic
971806650 4:31367007-31367029 CTCTGTAAGATGAAGGAGGAAGG + Intergenic
972387057 4:38577389-38577411 GGCTGTGAGTGGAGAGAGGAGGG + Intergenic
972668299 4:41189352-41189374 GTCTGGAAGGGGCAGGAGGAAGG + Intronic
972866416 4:43238627-43238649 GTCTGAGAGGGGAGAGAGTATGG - Intergenic
973210376 4:47608478-47608500 GACTGTGAGAGGAAGGAAGCAGG + Intronic
973228639 4:47816683-47816705 GTCTGTTGGTTGAAGGAGGAGGG + Intronic
973789000 4:54361546-54361568 GCCTGTGAGCTGAAGGAGGATGG + Intergenic
975360217 4:73460937-73460959 GAGGGGGAGGGGAAGGAGGAGGG - Intergenic
975452357 4:74544126-74544148 GTTTGTGAGTGGTAGGAGGATGG + Intergenic
976340240 4:83939180-83939202 GGCTGGGAAGGGAAGGAGGAAGG - Intergenic
976385701 4:84455475-84455497 GTTTGTGATGGGAAGGTGTAAGG - Intergenic
976497753 4:85750026-85750048 GTACGTGAGGGGCAGGTGGATGG - Intronic
976546786 4:86344654-86344676 GAATATGAGGGGAGGGAGGAAGG + Intronic
976616789 4:87086413-87086435 GGGTGGGAAGGGAAGGAGGACGG - Intronic
976753874 4:88477576-88477598 GGATGGGAAGGGAAGGAGGAGGG + Intronic
976789199 4:88858719-88858741 GGCTGGCAGGGGATGGAGGAGGG + Intronic
977435794 4:96992632-96992654 TTCTGTGATGGGAAGAAAGAGGG + Intergenic
977569280 4:98612814-98612836 CCCTGTGGGGGGAGGGAGGAAGG - Intronic
980094449 4:128474889-128474911 GTCTGTGAGGAGAATGAGGAAGG + Intergenic
980458011 4:133069996-133070018 GCCTCTGTGGGGAAGGAGAAAGG - Intergenic
981033765 4:140151279-140151301 ACCTGGGAGGGGAGGGAGGAGGG + Intronic
981081311 4:140642067-140642089 GTCCGGGAGGGGGCGGAGGAGGG + Intronic
981642225 4:146957718-146957740 GGCTTTTAGGGGAAGGAGTAAGG + Intergenic
981780636 4:148425582-148425604 GTCAGTGTGGGGAATGAGCAAGG + Intronic
982181307 4:152751011-152751033 GTGAGTGGGGGGAGGGAGGAGGG + Intronic
982206993 4:153004295-153004317 GTGTGTGGGGAGGAGGAGGAAGG + Intergenic
982314200 4:154014831-154014853 GTCTGTGAGGAGAGAGAGAAAGG - Intergenic
982677630 4:158394299-158394321 GTGTTTGAAGTGAAGGAGGAAGG + Intronic
983344872 4:166515531-166515553 ATGTGTGAGGAGAAGGATGATGG - Intergenic
984781671 4:183531824-183531846 GTTTTTGGGGGAAAGGAGGAGGG + Intergenic
984877982 4:184386327-184386349 GTCTGTGTTGGGAAGAAGGAAGG + Intergenic
985295200 4:188430488-188430510 CTCTGAGAGGGAAAGAAGGACGG - Intergenic
985388328 4:189468163-189468185 GGCAGTGAGGGGCTGGAGGATGG - Intergenic
985668591 5:1194957-1194979 GTCTGTGTGGGCAAGGTGTATGG + Intergenic
985846813 5:2355959-2355981 GGCTGGGAGGGAGAGGAGGAGGG - Intergenic
986183625 5:5416971-5416993 GAGGGAGAGGGGAAGGAGGACGG + Intergenic
986858305 5:11898060-11898082 GTCCCTGTGGGGAGGGAGGAGGG + Intronic
987536529 5:19196396-19196418 GTGTGTGAGTGGGAGGAGGCGGG + Intergenic
988390156 5:30617158-30617180 GACTGTGAGGGGTGGGGGGAAGG - Intergenic
988441632 5:31240538-31240560 GCCTGTGAGGTGCAGGATGATGG - Intronic
989474343 5:41857185-41857207 GTGTGGGAGGGGAAGCAGGGAGG - Intronic
989477737 5:41893236-41893258 GGAAGGGAGGGGAAGGAGGAAGG + Intergenic
989543114 5:42641124-42641146 GTCTATCAGGGGAAGGAGGAAGG - Intronic
989736221 5:44710134-44710156 TTTTGTGTGGGGAAGGTGGAAGG - Intergenic
990539366 5:56757114-56757136 GGCTGTGAGGGGAAGGAAGAGGG - Intergenic
991371655 5:65925858-65925880 GACGGCGAGGGGAGGGAGGACGG - Intergenic
991464019 5:66891331-66891353 GGCAGTGAGGAGGAGGAGGAGGG - Intronic
992135113 5:73736836-73736858 GTTGGTGAGGGGAGGGAGGGAGG + Intronic
992343561 5:75851904-75851926 CTCTGGGAGGCCAAGGAGGATGG - Intergenic
992585961 5:78240054-78240076 GTGTGAGAGCGTAAGGAGGATGG - Intronic
992636622 5:78730952-78730974 GGAGGTGAGGGGAAGGAGGCAGG + Intronic
992914583 5:81434888-81434910 GTCTGGGAGTGGAAAGAGGCAGG + Intronic
993094529 5:83465953-83465975 GGCAGGGAAGGGAAGGAGGATGG - Intergenic
993363734 5:87009504-87009526 TTCTCTGAGAGGAAGGAGCAAGG + Intergenic
993741454 5:91545826-91545848 GTCTTTCAGGGGGTGGAGGATGG - Intergenic
993880556 5:93355815-93355837 GTCTAAGAAGGGAAGGAAGAGGG + Intergenic
994367080 5:98928653-98928675 GTCCGTGCGGGGGAGGGGGAAGG + Exonic
995226043 5:109702351-109702373 GTCTGTGTGTGTAGGGAGGATGG + Intronic
995294419 5:110502672-110502694 GTGAGTGAGGGGAAAGTGGAAGG - Intronic
995352348 5:111194145-111194167 GTCTTGGAGGTGCAGGAGGAAGG - Intergenic
996111288 5:119569694-119569716 GTCTGTGTGGGGATGGGGGTGGG + Intronic
996756905 5:126945257-126945279 CTCTCTGGGGGAAAGGAGGAGGG - Intronic
996778706 5:127160312-127160334 GTTTGGGAGGGGAATGGGGATGG - Intergenic
997334431 5:133095856-133095878 GGCTGTCAGGGGATGGGGGAGGG - Intronic
997462991 5:134067649-134067671 GGCGGTGAGGGGGAGGGGGAGGG + Intergenic
997952080 5:138250286-138250308 TCCTGGGAGGGGAAGAAGGAAGG + Intergenic
998169402 5:139863798-139863820 GTGTGGGAGGCCAAGGAGGAAGG - Intronic
998173994 5:139889643-139889665 GTTTGTAATGGGAAGGGGGAGGG - Intronic
998464468 5:142332328-142332350 GTATGTGAGGAGCAGAAGGAAGG + Intergenic
999241747 5:150131931-150131953 GGCAGGGAGGGGAAGGAGCAGGG + Intronic
999517186 5:152313455-152313477 GTCAGGGAGGAGAAGGGGGAAGG - Intergenic
999652091 5:153777677-153777699 GTGTGTGAGGGGGATGAGGGTGG - Intronic
999707620 5:154288070-154288092 TTCTTTGAGAGGAAGGTGGAGGG + Intronic
1000245953 5:159448736-159448758 CTCTGAGAGGGGAAGGAAGCGGG + Intergenic
1000268189 5:159657979-159658001 GGCTGGGAGGGGAAGGTGGGTGG + Intergenic
1000592682 5:163177447-163177469 TCCTGTGAGGGAAAGCAGGATGG + Intergenic
1001266216 5:170276390-170276412 GTCTGGGAGGGGAAGATGGAAGG - Intronic
1002466799 5:179412325-179412347 GTCGGTGGGGGAAAGGTGGAAGG - Intergenic
1002466837 5:179412416-179412438 GTCGGTTGGGGGAGGGAGGAAGG - Intergenic
1002467074 5:179412964-179412986 GTCGGTGGGGGGAGGGTGGAAGG - Intergenic
1003064864 6:2895257-2895279 GTGGGTGAGGAGAGGGAGGAGGG + Intronic
1003084775 6:3052738-3052760 GTCGGTGAGGCCGAGGAGGAGGG + Intergenic
1003456979 6:6292359-6292381 GTCTGTGAGGGGTGGAAGGGAGG - Intronic
1003514115 6:6804247-6804269 CTATGGGAGGGGAAGGAGGCAGG + Intergenic
1004022768 6:11789752-11789774 GTCTTTGAGGGGAACTGGGAAGG - Intronic
1004619515 6:17320781-17320803 GTCTTTGAGGGGAACTGGGAAGG + Intergenic
1005339686 6:24831551-24831573 GTCTCTGAGGGGCATGAAGAGGG - Intronic
1005882155 6:30070065-30070087 CTCTGGGAGAGGAAGGAAGAGGG + Exonic
1005997097 6:30938218-30938240 ATCTGGGAGAGGAAGAAGGAAGG - Intergenic
1006088662 6:31615182-31615204 GTCTGGGAGGCAGAGGAGGAAGG + Exonic
1006200502 6:32284642-32284664 GGGTGTGAGGGGCAAGAGGAGGG + Intergenic
1006224066 6:32521660-32521682 TTGTGGGAGGGGAAGCAGGAGGG - Intronic
1006240190 6:32671368-32671390 GCCTGTGAGGGGTAGGGGCAGGG - Intergenic
1006316948 6:33297081-33297103 GTCTGGGATGAGGAGGAGGATGG - Exonic
1006375541 6:33669866-33669888 GTCTGTGAGGAGGAGGCAGAGGG + Intronic
1006437583 6:34034202-34034224 GCCTGGGAGGGGCAGGAGAAGGG - Intronic
1006510801 6:34520083-34520105 GTGAGTGATGGGAGGGAGGATGG + Intronic
1007241744 6:40431657-40431679 GTCTGGCTGGGGAAGGAGGAGGG - Intronic
1007373955 6:41443757-41443779 GTGTGCGAGGGGATGGGGGAAGG + Intergenic
1007414169 6:41682582-41682604 GGCTGTGAGAGGAAGCAGGTGGG + Intergenic
1007658764 6:43469317-43469339 GTCTGTGCTGGGAAGGAGTCAGG + Intergenic
1007751301 6:44073524-44073546 GGGTGGGAGGGGGAGGAGGAGGG + Intergenic
1008000204 6:46352404-46352426 TCCTCAGAGGGGAAGGAGGACGG - Intronic
1008375828 6:50790331-50790353 GTGTGAGAGGGGAAGGAGGTGGG - Intergenic
1008399735 6:51050847-51050869 GTCTGTGACTAGCAGGAGGAAGG + Intergenic
1008563651 6:52746643-52746665 GTCTGTGAAGGGCAGGCTGATGG + Intergenic
1008568089 6:52788945-52788967 GTCTGTGAAGGGCAGGCTGATGG + Intergenic
1008572277 6:52827525-52827547 GTCTGTGAAGGGCAGGCTGATGG + Intergenic
1008579526 6:52894221-52894243 GTCTGTGAAGGGCAGGCTGATGG + Intronic
1009750675 6:67875250-67875272 GCCTGTCAGAGGAAGGTGGAGGG + Intergenic
1010445488 6:75944255-75944277 AACAGTGAGGGGAAGGAGGAAGG - Intronic
1010702310 6:79065045-79065067 GAATATGATGGGAAGGAGGAAGG - Intronic
1010732164 6:79402843-79402865 GTGTCTGAGTGGAAGAAGGAAGG - Intergenic
1012992544 6:105940505-105940527 GTCTGTGAGTAGAACTAGGAAGG - Intergenic
1013244752 6:108275791-108275813 GTCTGGGAGGCCAAGGGGGAAGG - Intergenic
1013317603 6:108957261-108957283 CTGTGTAAGGGGAAGGTGGAGGG - Intronic
1013759762 6:113503578-113503600 GTGTGTGAGTTGAAGGGGGAGGG + Intergenic
1013891081 6:115027863-115027885 GTCTGTAAAGGGAAGGAGATAGG - Intergenic
1014358232 6:120438557-120438579 TGGGGTGAGGGGAAGGAGGAGGG + Intergenic
1015194025 6:130505605-130505627 GTCTGTGAAGGGTAGTAGGGAGG + Intergenic
1015248836 6:131105401-131105423 GTCTGTTAAGGGAAGGAAAAGGG + Intergenic
1015295603 6:131588675-131588697 TACTGGGAGGGGTAGGAGGATGG + Intronic
1015319245 6:131853668-131853690 GTGTGTGAGGGTAAGGTGGGAGG + Intronic
1015576612 6:134678605-134678627 AACTGTGAGGGAAAGCAGGATGG - Intergenic
1015718554 6:136216688-136216710 TTCTGTGGGCGGAAGGATGAAGG - Intergenic
1015950367 6:138546963-138546985 GTCTCTGTGGGGAAGGACCACGG - Intronic
1015984246 6:138869809-138869831 GTCTTTCAGGGGGAGGAAGAAGG - Intronic
1015988560 6:138911656-138911678 ATGTGTGAGGGAGAGGAGGATGG + Intronic
1015988569 6:138911699-138911721 ATGTGTGAGGGAGAGGAGGACGG + Intronic
1015988578 6:138911742-138911764 ATGTGTGAGGGAGAGGAGGATGG + Intronic
1015988588 6:138911785-138911807 ATGTGTGAGGGAGAGGAGGAGGG + Intronic
1015988602 6:138911874-138911896 ATGTGTGAGGGAGAGGAGGACGG + Intronic
1016650761 6:146456690-146456712 GGCTGAGAAGGGTAGGAGGATGG - Intergenic
1016798432 6:148143116-148143138 GACTGGCTGGGGAAGGAGGATGG + Intergenic
1017061033 6:150485155-150485177 GTCTGGGAAGGGAAGCAGGTGGG - Intergenic
1017129287 6:151094164-151094186 GTCAGTGGGGAGAAGGAGGCGGG - Intronic
1017286264 6:152680157-152680179 GTGTGTGAGGGGAGGGGAGATGG - Intergenic
1017301619 6:152867593-152867615 GTATGTGAGGTGAGGGTGGATGG - Intergenic
1017452424 6:154566367-154566389 GTCCATGATGGTAAGGAGGAGGG + Intergenic
1017601038 6:156081491-156081513 GTGGGTGATGGGAAGGACGAGGG + Intergenic
1017679674 6:156850920-156850942 ATCTGTGAGTGGAAAGATGATGG - Intronic
1018706305 6:166465779-166465801 GTCTGTGAGCAGCTGGAGGACGG + Intronic
1018921297 6:168177708-168177730 GCCTGCGTGGGGAAGGAGGCAGG - Intergenic
1019050232 6:169176972-169176994 GCCTCTGAGGGCCAGGAGGAGGG + Intergenic
1019168081 6:170112305-170112327 TTTTGGGAGGGGTAGGAGGAAGG - Intergenic
1019345392 7:527177-527199 GGGTGGGAGGGGGAGGAGGAAGG + Intergenic
1019806463 7:3129929-3129951 GGAAGTGAGGGGAAGGAGGGAGG + Intergenic
1020045417 7:5036795-5036817 GTCTGTGAGGCTGGGGAGGATGG - Intronic
1020390456 7:7652015-7652037 GTCAGGGAGGGGTAGAAGGAAGG + Intronic
1021682755 7:23151299-23151321 ATCAGTGTGGGAAAGGAGGATGG - Intronic
1022109130 7:27217285-27217307 GTGTGTGTGGGGAAGGTGGTGGG + Intergenic
1022165974 7:27762703-27762725 TTTTGTGAGGCCAAGGAGGATGG + Intronic
1022186262 7:27972413-27972435 CTCTTTTAGGGGAAGGAGGATGG + Intronic
1022573839 7:31478980-31479002 TTCTGTGAGGTGAAGAAGCAAGG + Intergenic
1022872643 7:34495385-34495407 TGCTGGGAGGTGAAGGAGGATGG - Intergenic
1022875203 7:34521056-34521078 GCCCAAGAGGGGAAGGAGGATGG + Intergenic
1022911739 7:34905436-34905458 GGCTGTGAGGGCGAGGAGAAGGG - Intergenic
1023167458 7:37356944-37356966 GTCTTTGGGGAGAAGGAAGAAGG - Intronic
1023458567 7:40368438-40368460 CTTTGGGAGGGCAAGGAGGAGGG - Intronic
1023542184 7:41277443-41277465 GTCTGGGAGAAGAAGGAAGAAGG - Intergenic
1023549682 7:41356649-41356671 GTCTGTGAGTGACAGGAGAAGGG + Intergenic
1023872018 7:44268461-44268483 GGCTGTGGGGTGAGGGAGGAGGG - Intronic
1024507066 7:50170637-50170659 TTCTATGAGGGGGAGGAGTAAGG + Intergenic
1024594515 7:50920847-50920869 GGCAGGGAGGGGAAGGGGGAAGG - Intergenic
1024977326 7:55125945-55125967 GAGTGTGAGGGGAAGTGGGATGG - Intronic
1025033171 7:55573101-55573123 GTCTGTGAGGACATGGAGGTGGG - Intergenic
1025996236 7:66529251-66529273 CTGTGGGAGAGGAAGGAGGATGG + Intergenic
1026134341 7:67646417-67646439 GCCTGGGAGAGGAAAGAGGAAGG - Intergenic
1026223194 7:68418225-68418247 GTATATGAGGAGAGGGAGGATGG - Intergenic
1026366084 7:69649958-69649980 GACTGTGTGGGGAAGGAAAAGGG - Intronic
1026523928 7:71138421-71138443 GTAGGTGAGGAGGAGGAGGAAGG + Intronic
1026734152 7:72938632-72938654 GTCTGGGAGCGGGAGGAGGCTGG - Exonic
1026774680 7:73223957-73223979 GTGAGTGTGGGGACGGAGGAGGG + Intergenic
1026899280 7:74028095-74028117 GGCTGTGAGGGAAAGAGGGAGGG - Intronic
1026988200 7:74568157-74568179 CTGTGGGAGAGGAAGGAGGATGG + Intronic
1027015539 7:74777348-74777370 GTGAGTGTGGGGATGGAGGAGGG + Intronic
1027072493 7:75168609-75168631 GTGAGTGTGGGGACGGAGGAGGG - Intergenic
1027150454 7:75729975-75729997 GGCTGTGAGGGCAGGAAGGAGGG + Intronic
1027251038 7:76398857-76398879 GTGTTTAAGGGGCAGGAGGATGG + Intronic
1027327201 7:77057949-77057971 GTCTGCGAGGCTGAGGAGGATGG - Intergenic
1027502001 7:78963977-78963999 GTTTGGGAGGGGAATGAGGGAGG + Intronic
1027711465 7:81607111-81607133 GACTGGGAGGGATAGGAGGAAGG + Intergenic
1028647907 7:93119186-93119208 TTCTGTGAGGGTGAGGAGGCAGG + Intergenic
1028778952 7:94714006-94714028 GTCGGTGGGGGGAAAGAGGACGG - Intergenic
1029074424 7:97924758-97924780 GTGCATGAGGGGATGGAGGATGG + Intergenic
1029402848 7:100356394-100356416 ACCTGTGAAGGGAAGGAGGGTGG + Intronic
1029418864 7:100461618-100461640 GGTTGTTAGGGGAAGGTGGAGGG - Intronic
1029659455 7:101949889-101949911 TTCTGAGAGGTGAAGGAGGCAGG + Intronic
1029710737 7:102298063-102298085 TTCTGGGAGGGCAAGGAGGCAGG + Intronic
1029817820 7:103114552-103114574 CTCTGAGAGGGCAGGGAGGAAGG - Intronic
1030052009 7:105546316-105546338 GTCTGTCAGGAGGAGTAGGAAGG + Intronic
1030103482 7:105967095-105967117 TGGGGTGAGGGGAAGGAGGAGGG - Intronic
1030547562 7:110916607-110916629 ATCTGTGTGGGGATGGAGGAAGG - Intronic
1030697809 7:112604592-112604614 TTCTGGGAAGGAAAGGAGGAAGG - Intergenic
1031077319 7:117225464-117225486 GACTGTGTGGGGAAGGAAGATGG + Intronic
1032442069 7:131949720-131949742 GTCTCTGTGGGGATGGGGGAGGG - Intergenic
1032680347 7:134176218-134176240 GCCTGTCAGGGGCGGGAGGAGGG + Intronic
1032738490 7:134714349-134714371 GGCTGGGAGGTGAAGGAGCATGG - Intergenic
1032810747 7:135413953-135413975 TACTGTTAGTGGAAGGAGGATGG - Intronic
1033297343 7:140152379-140152401 CTCTGGGAGGCCAAGGAGGATGG + Intronic
1033320041 7:140331174-140331196 GTCTGTGTGGGGAGGGGAGAAGG + Intronic
1033537986 7:142329226-142329248 CTCTGTGATGGGAAGGAAGGAGG - Intergenic
1033551527 7:142452009-142452031 CTCTGTGATGGGAAGGAAGGAGG - Intergenic
1033907357 7:146221981-146222003 GTTTGTGAAAGGAAGGAGGGAGG + Intronic
1034191014 7:149213544-149213566 GCTTATGAGGGTAAGGAGGATGG + Intronic
1034262214 7:149764282-149764304 GTCTGTGTGTGGATGGAGGTGGG + Intronic
1034267877 7:149789918-149789940 CTCTGGGATGGGAAGGAGCAGGG + Intergenic
1034426261 7:151015847-151015869 TCCTGTGAGGGGAGGGAGAAAGG - Intronic
1034426338 7:151016150-151016172 GGCTGTGAGGGGCTGGAGCAGGG + Exonic
1034570892 7:151955556-151955578 GTCTGTGAGTGGAAGGGGGTGGG - Intergenic
1034970985 7:155418959-155418981 CTCTGTGAGGAGGTGGAGGAAGG + Intergenic
1035122475 7:156579748-156579770 GTCTGTGAGTGGTGGGGGGAGGG + Intergenic
1035644754 8:1210456-1210478 GTGTGTGGGGGGAAGGAGAGGGG + Intergenic
1035740991 8:1928625-1928647 ATCTGTGTAGGGACGGAGGAGGG + Exonic
1035969366 8:4229794-4229816 GTTTGTGAGGGAAAAAAGGAAGG - Intronic
1036081120 8:5557085-5557107 GTGGGTGGGGGGAAGGGGGAGGG - Intergenic
1036243284 8:7096532-7096554 GTACATGAGGGGATGGAGGATGG - Intergenic
1036898547 8:12654898-12654920 GTACATGAGGGGATGGAGGATGG + Intergenic
1037877313 8:22554433-22554455 TCCTCTGTGGGGAAGGAGGAAGG - Exonic
1037908100 8:22727315-22727337 GGATGGGAGAGGAAGGAGGATGG + Intronic
1037926908 8:22850814-22850836 CTCAGGGAGGGGTAGGAGGAAGG + Intronic
1038067074 8:23974369-23974391 GTGGGGGAGGGGAGGGAGGAGGG + Intergenic
1038560573 8:28575544-28575566 GCCTCTGAGGGAAGGGAGGAGGG + Intergenic
1038885170 8:31655430-31655452 TTCTGTTAGGGTAGGGAGGAGGG + Intronic
1039105486 8:33984941-33984963 GTCAAGGAGGGGATGGAGGATGG - Intergenic
1039440283 8:37590485-37590507 GTGTGTGTGGGATAGGAGGAGGG - Intergenic
1039477192 8:37845381-37845403 GCTTGTTAGGGGAAGGTGGAGGG + Intronic
1039587515 8:38719580-38719602 GACTGTAAAGGGAGGGAGGAGGG - Intergenic
1039977216 8:42377289-42377311 GCCTGTGTGGGGCAGGAGGAAGG - Intergenic
1040563947 8:48549376-48549398 TTTTGGGAGGGGAAGGAGGGGGG + Intergenic
1040637744 8:49295401-49295423 ATCTGTGAGGGAAAAGAGAATGG + Intergenic
1040826276 8:51623848-51623870 CTCTGTGAGGCCAAGGTGGAAGG + Intronic
1040884791 8:52249949-52249971 GTCGGGGGGAGGAAGGAGGAAGG - Intronic
1040895680 8:52366108-52366130 CGCTGTGAGGGGGAGGAGGTAGG + Intronic
1040943330 8:52854627-52854649 GTCTGGGAGGAGCATGAGGAAGG - Intergenic
1041077654 8:54183964-54183986 TTCTGTGAGGGGAGGAAGGTTGG - Intergenic
1041141987 8:54830422-54830444 GTCAGTGGGGGGAGGGAGTAGGG - Intergenic
1041197225 8:55412149-55412171 GTCACTGAGGGGAAGAAGAAAGG + Intronic
1041340071 8:56835619-56835641 GTTTGTGGGGGGAAGGAGGAAGG - Intergenic
1041684179 8:60627504-60627526 ATCTGGGTGGGGAAGGAGGGAGG - Intergenic
1041865951 8:62573113-62573135 GTATGTCATGGCAAGGAGGAAGG - Intronic
1042140748 8:65676142-65676164 GTGTGTGTTGGGAAGGGGGAAGG - Intronic
1042191796 8:66194551-66194573 CTCTGGTCGGGGAAGGAGGAAGG + Intergenic
1042311045 8:67379788-67379810 GATGGGGAGGGGAAGGAGGAAGG - Intergenic
1043375226 8:79641589-79641611 GTGTGTGAGAGGGAGGAGCAGGG - Intronic
1043516170 8:80996792-80996814 TTGAGTGAGGGGAAGGTGGAGGG + Intronic
1044149513 8:88757724-88757746 GGCTGGGAAGGGTAGGAGGAAGG - Intergenic
1044252680 8:90022507-90022529 TTCAGTGAGGGGCAGGAAGATGG + Intronic
1044553770 8:93540054-93540076 GTTTATGAGGCGAAGAAGGAAGG - Intergenic
1045081368 8:98629402-98629424 GTTTGTGAGAGGAAGGAAGGTGG - Intronic
1045264427 8:100607139-100607161 GTCTGGGAGGGGGTGGAGCAGGG + Intronic
1045271101 8:100662334-100662356 GCCTGTCAGGGGCAGGAGTAGGG + Intronic
1046057961 8:109100842-109100864 GTAGGTGAAGGGAAGGAAGATGG + Intronic
1046229174 8:111331090-111331112 GTCTGTCAGGGACAGGTGGAGGG - Intergenic
1046516006 8:115261376-115261398 ATCTGGGAGGCCAAGGAGGACGG + Intergenic
1046994083 8:120496254-120496276 GTGAGTGATGGGAAGGAAGAGGG + Intronic
1047248203 8:123162162-123162184 TTCTGTGGGGGGAAGTAGAATGG - Intergenic
1047336900 8:123944763-123944785 CCCTGTGAGGGAAAGGAGGCTGG - Intronic
1047983244 8:130205174-130205196 CTATGTGAGAGGAAGGAAGAAGG - Intronic
1048298502 8:133234294-133234316 GTATGTGGGGGGAAGGGGGCAGG + Intergenic
1049291460 8:141805140-141805162 GTATCCTAGGGGAAGGAGGATGG + Intergenic
1049337354 8:142093530-142093552 GTCTGTGCGGGGAAGCAAGCGGG + Intergenic
1049359557 8:142205810-142205832 GGATGTGAGGGGAAGGGGGAAGG + Intergenic
1049938588 9:523232-523254 GTCTGTGGGGAGAAGGAGTTTGG - Intronic
1049963756 9:760345-760367 GAGGATGAGGGGAAGGAGGAGGG + Intergenic
1050123221 9:2330033-2330055 ATCTGTCAGGGGCAGGGGGAGGG - Intergenic
1050416363 9:5421405-5421427 TTCTGTGAGGGGAAAAAGCAGGG - Intronic
1050696597 9:8286198-8286220 CCCTGTGAAGGGGAGGAGGAAGG - Intergenic
1050820916 9:9878865-9878887 GATTGTGGAGGGAAGGAGGAAGG - Intronic
1050985637 9:12078657-12078679 GGGGGTGGGGGGAAGGAGGAGGG - Intergenic
1051286951 9:15507404-15507426 CTCTGGGAGGGCAAGGTGGATGG + Intronic
1051423245 9:16909584-16909606 GTGTTTGTGGGGATGGAGGAAGG + Intergenic
1051428927 9:16962440-16962462 GTCTTTGAAGGCAAGGAGTATGG + Intergenic
1051528792 9:18077077-18077099 GTCTGGGAGGAGGAGGAGGAGGG + Intergenic
1051718076 9:20006331-20006353 GTGGGTGAGGGGAGGGGGGATGG + Intergenic
1051735172 9:20190323-20190345 ATCTGAGAGAGGTAGGAGGATGG - Intergenic
1051834054 9:21314764-21314786 GCCTGGGAGGGGTAGGAGGATGG + Intergenic
1052049735 9:23831318-23831340 GAGTGAGAGGGGGAGGAGGAGGG - Intergenic
1052102279 9:24463222-24463244 ATCTGTGGGGGGAAAGGGGAAGG - Intergenic
1052625348 9:30968459-30968481 GTCTTTAATGGAAAGGAGGAAGG + Intergenic
1052796893 9:32931285-32931307 CCCTCTGATGGGAAGGAGGAGGG - Intergenic
1052947344 9:34179023-34179045 GGCGGTGAGGGGAAGGAGGAGGG + Exonic
1053218266 9:36290656-36290678 GCTTGGGAGGGGAAGGACGAGGG - Intronic
1053313188 9:37032345-37032367 GTATGTGTGGGGAATGAGGCGGG - Intronic
1053670434 9:40356177-40356199 GTCTTTCAGGGGAAGAAGAATGG + Intergenic
1053920222 9:42982440-42982462 GTCTTTCAGGGGAAGAAGAATGG + Intergenic
1054381552 9:64496161-64496183 GTCTTTCAGGGGAAGAAGAATGG + Intergenic
1054514179 9:66020123-66020145 GTCTTTCAGGGGAAGAAGAATGG - Intergenic
1055058550 9:72045935-72045957 GTGTGTGGGGGGAAGGAAGGTGG + Intergenic
1055359867 9:75478091-75478113 GCCTGTGGGGGGATGGAGAATGG + Intergenic
1055581441 9:77711054-77711076 GATGGGGAGGGGAAGGAGGAGGG - Intergenic
1055872650 9:80902085-80902107 GTGGGTCAGGGGAAGGAGGGAGG + Intergenic
1056040062 9:82656132-82656154 GGCTGGGAAGGGAAGAAGGAAGG + Intergenic
1056266059 9:84897703-84897725 GTTTGTGAGGGTGTGGAGGAAGG - Intronic
1056449727 9:86705208-86705230 GTCTGAGAGGCAAAGGAGGCTGG - Intergenic
1056681114 9:88720057-88720079 GTTTGTGAGGAGAACAAGGAAGG + Intergenic
1056793282 9:89639856-89639878 GGCTCTGGGGGGAAGGAGGATGG + Intergenic
1056822972 9:89856574-89856596 GACTGTGCTGGGAAGGAGGTGGG - Intergenic
1057147121 9:92765478-92765500 GTCTGGGGGCGGGAGGAGGACGG + Intergenic
1057214279 9:93219458-93219480 GTCTCTGAGGGGAAAGGGAAAGG - Intronic
1057431137 9:94995288-94995310 GTTTCTGAGGGGAAAGAGGAAGG + Intronic
1058068389 9:100574920-100574942 GGCTGTGAGGGCAACAAGGAGGG - Intronic
1058093555 9:100833033-100833055 GTGGGTGGGGGGAAGGAGGAGGG + Intergenic
1059086712 9:111310893-111310915 GGCTGAGAGGGGGAGGAGGGAGG - Intergenic
1059405702 9:114097435-114097457 ACCTGGGAGGGGAGGGAGGAGGG + Exonic
1059542184 9:115142116-115142138 GTCTGAGAGAAAAAGGAGGAAGG - Intronic
1060238548 9:121884146-121884168 CTCTGGGAGGGGGAGGTGGATGG - Intronic
1060368377 9:123043634-123043656 GGGGGTGAGGGGAAGGAGGGTGG + Intronic
1060776310 9:126377190-126377212 GTCTCTGAGGAGGAGCAGGAGGG - Intronic
1060895882 9:127216966-127216988 GGCGGTGCGGGGAAGGAGGCAGG + Intronic
1060968441 9:127724444-127724466 GCCCCTGGGGGGAAGGAGGAAGG + Intronic
1061471630 9:130831339-130831361 GTGTGTCAAGGGAAGGAGGCAGG - Intronic
1061537279 9:131257972-131257994 GTATCTGGGGGGCAGGAGGATGG - Intergenic
1061597555 9:131641779-131641801 GTTGGTGACGGGAAGGAGGCAGG - Intronic
1061901097 9:133672503-133672525 GTCTGCGAGGAGCAGGGGGAAGG + Intronic
1062166987 9:135112833-135112855 GTCCCTGAGGGGGAGAAGGAAGG + Intronic
1062273999 9:135722107-135722129 GGCTGTGGGGGCATGGAGGAGGG + Intronic
1203429634 Un_GL000195v1:79538-79560 GCCTGTGATGGAAAGGAGAAGGG + Intergenic
1203360550 Un_KI270442v1:217086-217108 GCCTGTGGGGGGAGGGAGAAGGG + Intergenic
1185550526 X:980193-980215 GGCTGCAAGGGGGAGGAGGAGGG + Intergenic
1185586315 X:1244376-1244398 GAATGTGAAGGGAAGGAAGAAGG + Intergenic
1185656587 X:1690446-1690468 CTGTGGGAGGGGAATGAGGAGGG - Intergenic
1185886667 X:3789421-3789443 GTGTGTGTGGGGAGGGAGCAGGG - Intergenic
1186112089 X:6269200-6269222 GTGTGTGAGGGGAAGGTGAGCGG - Intergenic
1186198357 X:7131900-7131922 GTCACTGAGGTGGAGGAGGAAGG - Intronic
1186270341 X:7879886-7879908 TTCTGAGTGTGGAAGGAGGAAGG - Intergenic
1186325076 X:8467179-8467201 GTGTGTGTGGGGAGGGAGGGAGG + Intergenic
1186381588 X:9066396-9066418 GGCTGAGAAGGGAAGGAGAAAGG + Intronic
1186520397 X:10201176-10201198 AGTGGTGAGGGGAAGGAGGAAGG + Intronic
1186569433 X:10698762-10698784 GCCTTTACGGGGAAGGAGGAAGG - Intronic
1186924531 X:14318344-14318366 GCCTGGGAAGGGTAGGAGGAGGG + Intergenic
1187138735 X:16573102-16573124 GCCTGTTAGGGGTAGGAGGTGGG + Intergenic
1187323911 X:18268617-18268639 CTCGGTGGGGGGAGGGAGGAGGG + Intronic
1188153094 X:26703750-26703772 GTATGTGAGTGGAGGGAGGGAGG + Intergenic
1188243352 X:27814193-27814215 GGGTGTGAGGGGCAGGGGGAGGG - Intronic
1188524539 X:31075010-31075032 CTCTCTGAGGAGAAGGAGGCAGG + Intergenic
1188844109 X:35052712-35052734 GGCTGTAATTGGAAGGAGGATGG - Intergenic
1189599660 X:42609563-42609585 GCCTGTCAGGGGATGGGGGAAGG + Intergenic
1189777248 X:44481603-44481625 GAGTGTCAGGGGAAAGAGGAAGG + Intergenic
1190233128 X:48597645-48597667 ATCTGAGAAGGGAAGGCGGAGGG + Intronic
1190285768 X:48960417-48960439 GGCTGTGAGGAGAGGAAGGATGG - Intergenic
1191754930 X:64582629-64582651 ATCTGTGAGGGAAAATAGGATGG - Intergenic
1192195885 X:69027929-69027951 GTCTCATAGGGGTAGGAGGAGGG - Intergenic
1192656451 X:72999829-72999851 GTGTGAGAGGGGATAGAGGAAGG - Intergenic
1192665669 X:73083172-73083194 GTGTGAGAGGGGATAGAGGAAGG + Intergenic
1192728555 X:73778557-73778579 ATCTGAGAGGGGATGGAGGCAGG + Intergenic
1193783161 X:85728663-85728685 GGCGGTGGGGGGAAGGGGGAGGG - Intergenic
1194216857 X:91140873-91140895 GTCTGTGAAGGGATAGTGGAGGG - Intergenic
1194500122 X:94672369-94672391 GCCTGTCTGGGGAAGGAGGTTGG + Intergenic
1194527204 X:94991207-94991229 CTCTGGGAGGGCAAGGCGGATGG + Intergenic
1194975922 X:100396031-100396053 GTGTGTGAGAGGTGGGAGGATGG - Intronic
1195322093 X:103728526-103728548 GTCTTGGAGGGGAGGGAGGAGGG + Exonic
1195380918 X:104269951-104269973 GACTGGGAAGGGAAGAAGGAGGG + Intergenic
1195596087 X:106691522-106691544 GGCTGGGAAGGGAAGGAGGAGGG - Intergenic
1195632586 X:107073959-107073981 GGCTGTGAAGGGTAGGAGGAAGG + Intronic
1195767175 X:108308117-108308139 GTGGCTGAGGGGATGGAGGATGG - Intronic
1195797640 X:108668509-108668531 GTCCGTGAGTGGTAGGAGAATGG + Intronic
1195813913 X:108864643-108864665 GTCTGGGAAGGGTAGAAGGAGGG - Intergenic
1196019070 X:110970596-110970618 GTGGGTGGGGGGAAAGAGGAGGG + Intronic
1196412960 X:115439196-115439218 GTCTTAGAGAGGAAGGAGGTAGG + Intergenic
1196544003 X:116941421-116941443 GTGAGTGGGGGGAGGGAGGAGGG - Intergenic
1196661114 X:118269784-118269806 GTTTGGGAGGGAAAGGAAGAGGG + Intergenic
1196763933 X:119225863-119225885 GTCTCTGAGGGTGGGGAGGAGGG - Intergenic
1197157035 X:123282303-123282325 GGCAGTGAAGGGAAAGAGGAGGG - Intronic
1197401604 X:125998699-125998721 GTCTACCAGGAGAAGGAGGAAGG + Intergenic
1197963505 X:132031480-132031502 GGCTGAGAAGGGAAGCAGGAGGG - Intergenic
1198279415 X:135126907-135126929 GTCTGTCAGGGGAAGGGGACAGG + Intergenic
1198291541 X:135245607-135245629 GTCTGTCAGGGGAAGGGGACAGG - Intergenic
1198713836 X:139534944-139534966 GTCTGGGAAGAGAAGGATGAAGG + Intronic
1199314826 X:146364171-146364193 CACTGTGAGGGGATGGGGGAGGG + Intergenic
1199677304 X:150199347-150199369 GCCTGTGAGGGGAGGGAAGGTGG + Intergenic
1200252762 X:154562489-154562511 GCCTGTGAAGGGTGGGAGGAGGG + Intronic
1200265005 X:154641927-154641949 GCCTGTGAAGGGTGGGAGGAGGG - Intergenic
1200283022 X:154794630-154794652 CACTGTGTGGGGAAGGAGAAGGG + Intronic
1201338476 Y:12905294-12905316 GTTTGTGAGGGGGCGGGGGAGGG + Intronic
1201573565 Y:15438712-15438734 GTCAGTGAGGTGGAGGAGGAAGG - Intergenic
1201710941 Y:16990914-16990936 TGGGGTGAGGGGAAGGAGGAGGG + Intergenic
1202247040 Y:22830584-22830606 GTCTGTAAGGGGAAAAAGAAAGG + Intergenic
1202400029 Y:24464332-24464354 GTCTGTAAGGGGAAAAAGAAAGG + Intergenic
1202470752 Y:25205754-25205776 GTCTGTAAGGGGAAAAAGAAAGG - Intergenic