ID: 930338271

View in Genome Browser
Species Human (GRCh38)
Location 2:50078595-50078617
Sequence CTGAAGGGACAAAGGAAACA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 704
Summary {0: 1, 1: 0, 2: 1, 3: 54, 4: 648}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
930338271_930338275 27 Left 930338271 2:50078595-50078617 CCATGTTTCCTTTGTCCCTTCAG 0: 1
1: 0
2: 1
3: 54
4: 648
Right 930338275 2:50078645-50078667 TTAACACTTTTGAAGAATACTGG 0: 1
1: 11
2: 93
3: 302
4: 882

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
930338271 Original CRISPR CTGAAGGGACAAAGGAAACA TGG (reversed) Intronic
900799584 1:4728955-4728977 CTCAGGGGATAATGGAAACATGG - Intronic
901937979 1:12640461-12640483 CGCAAGGAACAAAGGAGACAAGG + Intergenic
903522527 1:23961802-23961824 CTGAAGGATTAAAGGAAACAGGG - Exonic
903581324 1:24373018-24373040 CAGAAGGGACAATGGAATGATGG + Intronic
904155316 1:28478275-28478297 ATGAAGGGATAAAGAAAACGTGG - Intronic
904591777 1:31619028-31619050 CTGAAGGGAGGAAGGAAAGGAGG - Exonic
904821921 1:33251103-33251125 CTGAAGGGACAGAAAGAACAGGG + Intergenic
904860081 1:33530709-33530731 ATGAATGGATAAAGAAAACATGG + Intronic
904946669 1:34204076-34204098 CTGAAGTGAGAAAGCAAAGAAGG + Intronic
904966900 1:34381155-34381177 CTGAAGAGACAAAATAAACTGGG - Intergenic
905001105 1:34670929-34670951 CAGAAGGCAAAAGGGAAACAAGG + Intergenic
905303273 1:36999808-36999830 CTAAGGGGACAAAGTAAGCAGGG - Intronic
905459825 1:38115184-38115206 GGGAAGAGACAAAGGAAACTAGG - Intergenic
905462372 1:38130083-38130105 CTGAAGGGGCAAGGGAAGGAAGG + Intergenic
907090310 1:51717973-51717995 ATGAATGGATAAAGAAAACATGG + Intronic
907518476 1:55008191-55008213 CTGCAGGGACAAAGACCACAAGG - Intronic
908440927 1:64153519-64153541 ATGAATGGATAAAGAAAACATGG + Intronic
908647902 1:66299439-66299461 ATGAATGGATAAAGGAAATATGG - Intronic
909089198 1:71204820-71204842 CTCAAGGGAGAGAGGTAACAGGG + Intergenic
909206918 1:72770152-72770174 TGCAAGGTACAAAGGAAACAGGG - Intergenic
909853877 1:80504210-80504232 CTGAAAGGTTAAAGGAAATATGG - Intergenic
909996587 1:82287522-82287544 CTGAAGGAAGAAAGGAAAAGAGG - Intergenic
910042433 1:82868898-82868920 CAGAAGGGATAAATGAAAAAAGG + Intergenic
910964448 1:92794187-92794209 AGGAAGGGAAAAAGGAAAGAAGG + Intergenic
911523036 1:98951363-98951385 CTGATGGGCTAAAGAAAACAGGG + Intronic
913342932 1:117778140-117778162 CTGAAGGATTAAAGGAAACAGGG + Intergenic
913581358 1:120230492-120230514 CTGGAGGGACAGAGGACAAAAGG + Intergenic
913626818 1:120667899-120667921 CTGGAGGGACAGAGGACAAAAGG - Intergenic
914563290 1:148841935-148841957 CTGGAGGGACAGAGGACAAAAGG + Intronic
914609537 1:149288288-149288310 CTGGAGGGACAGAGGACAAAAGG - Intergenic
914822936 1:151119306-151119328 CTCAAAGGAAAAAGGAAACTAGG + Exonic
914989263 1:152484461-152484483 TGTAAGGGAGAAAGGAAACAGGG - Intergenic
916231519 1:162545474-162545496 CTGACGGCAGCAAGGAAACAGGG + Intergenic
916323156 1:163528361-163528383 ATGAATGGATAAAGAAAACATGG + Intergenic
916510323 1:165467504-165467526 CTGAAGGGAGGAGGGAAAGAGGG + Intergenic
916593685 1:166220783-166220805 ATGGAAGGACACAGGAAACATGG - Intergenic
917182291 1:172312587-172312609 CTTAAGAGACAAAAGAAACAGGG - Intronic
917483393 1:175432608-175432630 CTGAAAGAAGAAAGGAAAGATGG - Intronic
918015354 1:180628352-180628374 TTGAAGGAACAAAGGAAAAGAGG - Intergenic
918228292 1:182507604-182507626 ATGAATGGATAAAGAAAACATGG - Intronic
918262144 1:182806005-182806027 CTGAAGTGAAAATGGAAACATGG + Intronic
918802018 1:188984820-188984842 CTGAAAGAAGAAAGGAAAGAAGG - Intergenic
919159671 1:193811958-193811980 CTGAGGGGATAAAGAAATCAAGG - Intergenic
919189247 1:194194726-194194748 CAGAAGGCAAAAGGGAAACAAGG - Intergenic
921153111 1:212417347-212417369 CTGATTGGCCAAAGGGAACAGGG - Intergenic
921262056 1:213393392-213393414 GTGAAGGGAGAAAAGACACAGGG - Intergenic
921333175 1:214060960-214060982 TTGAAGTTACAAAGGAAACCAGG + Intergenic
921448498 1:215274729-215274751 GTGAAGGAAGAAAGGAAAGAAGG - Intergenic
922135691 1:222823792-222823814 CTGAAGCAACAACGTAAACAAGG - Intergenic
922713985 1:227856635-227856657 ATGAATGGATAAAGCAAACATGG + Intergenic
923493366 1:234504102-234504124 CTAAAAGGACAATGGGAACAAGG - Intergenic
923652952 1:235890676-235890698 ATGAAGGAAGAAAGAAAACATGG - Intergenic
924438141 1:244063720-244063742 CAGAAGGGAGAGATGAAACATGG + Intergenic
1062960390 10:1568849-1568871 CTAAATGGACAAAGCACACACGG + Intronic
1063280285 10:4621182-4621204 ATGAATGGATAAAGAAAACATGG + Intergenic
1063422049 10:5920755-5920777 CTGGAGGGGCGAAGGAAGCAGGG + Intronic
1063907954 10:10799549-10799571 TTGAAGGGTCAAGGGAAACTTGG + Intergenic
1064121564 10:12623487-12623509 AGGAAGGGAGAAAGGAAAGAAGG - Intronic
1064447096 10:15405446-15405468 ATGAATGGATAAAGAAAACATGG + Intergenic
1064895300 10:20228632-20228654 CGGAAGGGAGGGAGGAAACAAGG + Intronic
1065297214 10:24288576-24288598 CTCAAGGGACAGAGCATACAAGG + Intronic
1065708201 10:28490471-28490493 ATGAATGGATAAAGAAAACATGG - Intergenic
1065765628 10:29026917-29026939 AGGAAGGAACAAAGGAAAGAAGG + Intergenic
1066035688 10:31481035-31481057 CTGGAAGGAGAATGGAAACAGGG - Intronic
1066149744 10:32603325-32603347 ATGAATGGATAAAGAAAACATGG - Intronic
1066497879 10:35959881-35959903 AGGAAGGGAAAAAGGAAAGAGGG - Intergenic
1067299690 10:44997124-44997146 CACAAGGGAGAAAGGGAACAAGG - Intergenic
1067672312 10:48334222-48334244 CTTAGGGGACAAAGGAAAGAGGG - Intronic
1067800858 10:49358649-49358671 ATGAATGGATAAAGGAAACATGG + Intergenic
1068009049 10:51425017-51425039 AGGAAGGGAGAAAGGAAAGATGG - Intronic
1068136825 10:52957177-52957199 TTCAAGGTACAAAGGAAACTAGG - Intergenic
1068138170 10:52971673-52971695 AGGAAGGGTCAAAGGGAACAGGG - Intergenic
1068601134 10:58957851-58957873 CTTAAAGGACAAAGGGAAAAAGG - Intergenic
1068964893 10:62902072-62902094 CTGACAAGACAAAGGAAAAAGGG - Intronic
1069235407 10:66065334-66065356 CTGAAGGGAAAGAGGAAATGGGG - Intronic
1072048038 10:91676519-91676541 ATGAAGGGACAAAGGAAGAGTGG - Intergenic
1072059418 10:91795220-91795242 ATGAATGGATAAAGAAAACATGG + Intergenic
1072200679 10:93156010-93156032 CTTAGTGGACAAAGAAAACAGGG - Intergenic
1072422957 10:95304793-95304815 CAGATGGGACCAAGGAAAGAGGG - Intergenic
1075517949 10:123124328-123124350 ATGAATGGATAAACGAAACATGG - Intergenic
1078277824 11:9867633-9867655 ATGAGTGGATAAAGGAAACATGG + Intronic
1078446728 11:11410181-11410203 CTGAAGGGAGAGAGGACACAGGG - Intronic
1078505757 11:11942957-11942979 ATGAAGGGAAAAAAGAAACATGG + Exonic
1079541275 11:21578449-21578471 GTGAAGGGACAAATGATACAAGG + Intergenic
1080905723 11:36543015-36543037 CTGAAGTGACAGAGAAAACGAGG - Intronic
1080918988 11:36689726-36689748 AGGAAGGGAGAAAGGAAAGAAGG - Intergenic
1080957134 11:37111122-37111144 GTGAGGGAGCAAAGGAAACAAGG - Intergenic
1081145332 11:39556447-39556469 ATGAAGGGAGAAAGAAAACCTGG + Intergenic
1081175809 11:39924959-39924981 CTGAAGGTAAAAAGGGGACAAGG + Intergenic
1081721369 11:45291160-45291182 CTTAAGGCACAAAGGAGAAAGGG + Intergenic
1082173261 11:49031757-49031779 CTGAATGCACAAAGTCAACAGGG + Exonic
1082744898 11:56950781-56950803 CCTAGGGGACAAAGGAAAGAGGG + Intergenic
1082838883 11:57672314-57672336 TTGAAGGGGCAAGGAAAACAGGG - Exonic
1083606638 11:63982796-63982818 CTGAATGGACCAAGACAACAGGG - Intronic
1083824389 11:65190234-65190256 CAGAAGTGAGAAAGGAAATAGGG - Intronic
1085428061 11:76422522-76422544 ATGAAGGAAGAAAGGAACCAAGG + Intergenic
1085458150 11:76677441-76677463 CTGAAGTGAAAAAGGAAAGGAGG + Intergenic
1085638293 11:78174778-78174800 AGGAAAGGAAAAAGGAAACAGGG + Intronic
1085795652 11:79537306-79537328 TTGATGGGCCAAAGGAAACATGG - Intergenic
1085830968 11:79900626-79900648 ATGAATGGATAAAGAAAACATGG + Intergenic
1085907011 11:80775581-80775603 ATGAATGGATAAAGAAAACATGG + Intergenic
1086195489 11:84134027-84134049 CTGAAGGAAGAAAGGAAAATGGG - Intronic
1086237237 11:84645892-84645914 CTGGATGGACATAGGAAACCTGG + Intronic
1086345372 11:85890694-85890716 CTGAAGGGAAGAGGGAAACATGG - Intronic
1087607973 11:100400403-100400425 ATGAACGGATAAAGAAAACATGG - Intergenic
1087876733 11:103367994-103368016 ATGAATGGATAAAGAAAACATGG - Intronic
1087997844 11:104833209-104833231 ATGAATGGACAAAGAAAACGTGG - Intergenic
1088249135 11:107847708-107847730 CAGGAGGGACAGAGGAAACAGGG + Intronic
1088971492 11:114778614-114778636 GTGAAGAGACAAGGGAAACCAGG + Intergenic
1090076241 11:123581588-123581610 CTGAGGGGCCACAGGAAAAATGG - Intronic
1090077146 11:123586717-123586739 CTGAAGGAACACAGAAAACCAGG - Intronic
1091153143 11:133348008-133348030 CTGAAGGGTCAGATGTAACAGGG - Intronic
1091364208 11:135004209-135004231 ATGAAGGGATAAAGAAAACGTGG - Intergenic
1091553171 12:1552292-1552314 CAGCAGTGTCAAAGGAAACATGG + Intronic
1091611943 12:2018016-2018038 CTCAAGGGACACAGGAAAACAGG + Intronic
1091658217 12:2361466-2361488 AGGAAGGGAGAAAGGAAAAAAGG - Intronic
1091826832 12:3519203-3519225 TGTAAGGGAAAAAGGAAACAGGG + Intronic
1091928923 12:4379066-4379088 TTGACGGGGCAAAGGGAACATGG + Intronic
1092514941 12:9201061-9201083 CTGAAGGGAAACAAGAAACATGG + Intronic
1093509595 12:19910588-19910610 ATGAATGGAGAAAGAAAACATGG - Intergenic
1093827881 12:23717034-23717056 TTGAAGGGCCAAAGTAAGCAAGG - Intronic
1093836706 12:23840125-23840147 CTGAAAGGCCAAAGGATGCAAGG + Intronic
1094292145 12:28863587-28863609 AGGAAGGGAGAAAGGAAAGAAGG - Intergenic
1095418824 12:42003963-42003985 ATGAATGGACAAAGAAAATATGG + Intergenic
1095686542 12:45042441-45042463 TTGCAGGGACAAAGGAAAAGAGG + Intronic
1096350435 12:50894642-50894664 ATGAAGGGACAAACAAAATATGG + Intergenic
1096750977 12:53758660-53758682 AAGAAGGAACAAAGAAAACAGGG - Intergenic
1096756650 12:53805014-53805036 GGGAAGGGAGAAAGGAAAAAAGG - Intergenic
1096761550 12:53845815-53845837 CTAAAAGGACAGAGGAAAGAAGG - Intergenic
1097131350 12:56812992-56813014 ATGAAGGGACAAAGGAAGGAAGG - Intergenic
1097161216 12:57047908-57047930 GGGAAGGGACAAAGGAAATTAGG + Intronic
1097180631 12:57169770-57169792 CTGAAGAGACAGAGGAGAGAGGG + Intronic
1097825658 12:64172508-64172530 ATGAAGGGAGAAAGGAAAAAAGG + Intergenic
1098892798 12:76026948-76026970 CTGTTGGGACAAAGGAAGGAAGG - Exonic
1099309343 12:80998359-80998381 CTAAAGTGTCAAAGGAAACGAGG + Intronic
1099517521 12:83615959-83615981 CTGAAGGCACAAATGTGACATGG - Intergenic
1099899341 12:88688560-88688582 ATGAATGGACAAAGGAAATGTGG + Intergenic
1100193203 12:92215181-92215203 ATGAATGGATAAAGAAAACATGG - Intergenic
1100273015 12:93044161-93044183 CAGAAGGGACAAAGGAGCGAGGG - Intergenic
1100287764 12:93183637-93183659 CTGATTGGATAAAGAAAACATGG - Intergenic
1100838985 12:98593402-98593424 GTGAAGGGACAAAGCGAGCAGGG + Intergenic
1101871124 12:108566332-108566354 GTGAAGGGAGAAATGAGACAAGG + Intronic
1102609053 12:114095255-114095277 CTGAAGGGACCAAAGAAATCTGG - Intergenic
1102734724 12:115149024-115149046 ATGAATGGATAAAGGAAATATGG - Intergenic
1103221668 12:119251484-119251506 CTGCAGGCAAAAAGGACACAGGG + Intergenic
1103669665 12:122602812-122602834 CTGTAGCTAGAAAGGAAACAAGG - Exonic
1104805235 12:131585827-131585849 CTCAGGGGACACAGGACACAGGG - Intergenic
1104809072 12:131609674-131609696 CTGAATGGATAAAGAAAACGTGG + Intergenic
1105600726 13:21884749-21884771 CTGAAGGGAAAATTAAAACAAGG - Intergenic
1105687917 13:22804507-22804529 CTAAAGGTACATAGGAAACATGG + Intergenic
1106239845 13:27902774-27902796 GTGAGAGGACAATGGAAACAGGG + Intergenic
1106306933 13:28520762-28520784 ATGAATGGATAAAGAAAACATGG - Intergenic
1106381661 13:29245348-29245370 CTGCAGGGAAAAAGGAATCCTGG + Intronic
1106993921 13:35458324-35458346 CTAAAAGGACAGAGAAAACATGG - Intronic
1107263660 13:38525307-38525329 CTGCTGGGACAAGGGAAATAAGG - Intergenic
1107790863 13:44001099-44001121 ATGAAGAGAAAAATGAAACATGG - Intergenic
1107846960 13:44524913-44524935 CTGGAAGGAGAAAGGAAAAAAGG + Intronic
1107904774 13:45051783-45051805 CTGATGGGACAAAAAATACAAGG - Intergenic
1108146327 13:47481080-47481102 CTTAAAAGACAAAGGAAGCAGGG + Intergenic
1108887111 13:55200063-55200085 CTCTTGGGACAAAGAAAACATGG - Intergenic
1109148435 13:58812820-58812842 CAGATTGGACAAAGAAAACATGG - Intergenic
1109291994 13:60487649-60487671 ATGAAGGGATAAAGAAAACGTGG - Intronic
1109934201 13:69259799-69259821 ATGAATGGATAAAGAAAACATGG + Intergenic
1110158229 13:72343758-72343780 CTGAAGGAACAAAGCAAGCAGGG - Intergenic
1110448200 13:75611913-75611935 ATGAAAGGATAAAGAAAACATGG - Intergenic
1110597084 13:77330683-77330705 CTGAAGGGAAAAATTCAACATGG + Intergenic
1110682761 13:78335695-78335717 GTGAAGGAAGAAAGGAAAGAAGG + Intergenic
1110915972 13:81021218-81021240 CCCTTGGGACAAAGGAAACATGG + Intergenic
1111059596 13:82998774-82998796 CTTAAGTGACAGAGGAAAAATGG - Intergenic
1111382009 13:87468251-87468273 ATGAATGGATAAAGGAAAAATGG + Intergenic
1111499387 13:89095665-89095687 CTGAGTGGATAAAGAAAACATGG + Intergenic
1111593425 13:90379364-90379386 ATGAATGGATAAAGGAAATACGG + Intergenic
1111829712 13:93311876-93311898 CTGAGGGTACAAAGGCAAGATGG + Intronic
1111923291 13:94435208-94435230 CTCAAGTGATAAAGAAAACATGG - Intergenic
1111997380 13:95178092-95178114 CTGTATGGACAAAGGAAAGAAGG + Intronic
1112014499 13:95320341-95320363 TTGAATGGATAAAGAAAACATGG + Intergenic
1112642773 13:101295588-101295610 CTAATTGGACAAAGGAAAAAAGG + Intronic
1113450601 13:110406924-110406946 CTGAAGGCATAAGGGGAACAAGG - Intronic
1113784926 13:112997477-112997499 CTGAAGGGACAGTGGACACGGGG - Intronic
1114335503 14:21685415-21685437 CTGAAAGGTCAAATGAGACAAGG - Intergenic
1114339235 14:21725621-21725643 ATGAATGGATAAAGAAAACATGG + Intergenic
1114813233 14:25925995-25926017 CTGATGGGAAAAGGGAAGCAGGG + Intergenic
1114997830 14:28379453-28379475 GTGAATGGATAAAGAAAACATGG + Intergenic
1115303591 14:31912594-31912616 ATGCAGGGACACAAGAAACAAGG - Intergenic
1116264986 14:42676471-42676493 ATGAATGGATAAAGAAAACATGG + Intergenic
1116671995 14:47854611-47854633 CTGAAGGGGCAAATGAAAGGAGG + Intergenic
1117481888 14:56154518-56154540 CTGAAGGCAAAAGGGAAGCAAGG - Intronic
1117606453 14:57433702-57433724 ATGAATGGATAAAGAAAACATGG - Intergenic
1118285442 14:64466119-64466141 CTCAAGGGAAAAAGGAAAGGGGG + Intronic
1118362571 14:65068904-65068926 CTGATGGGACAAAGGAGGCAAGG + Intronic
1118692766 14:68355674-68355696 CTAAAAGTACAAAGGAAAAATGG + Intronic
1118730801 14:68664974-68664996 CTGAAAGGACAGAAGGAACATGG - Intronic
1119764739 14:77181412-77181434 CTGATGGGACTAAGGAGACTGGG + Intronic
1120050031 14:79855022-79855044 GAGAAGAGACAAAGGAAAGAGGG - Intronic
1120162553 14:81161454-81161476 CTGAAAGGACAGAAAAAACAGGG - Intergenic
1120256558 14:82127244-82127266 ATGAAGGCAAAAAGGATACAGGG - Intergenic
1120423493 14:84316963-84316985 ATGTAGGAACACAGGAAACATGG + Intergenic
1121123328 14:91390149-91390171 CTGAGGGAACAAAGTAACCATGG - Intronic
1121503218 14:94456080-94456102 CTCAAGGAACTAGGGAAACAAGG - Intergenic
1122147480 14:99700214-99700236 CTGAAGGGAGAGAGGAAAAAGGG + Intronic
1122439378 14:101719551-101719573 ATGATGGGACACAGGACACAGGG + Intergenic
1122494427 14:102142064-102142086 CTGAAGGGTAAAAGGAGGCAAGG + Intronic
1124993613 15:34700607-34700629 ATGAATGGATAAAGAAAACAGGG - Intergenic
1125121234 15:36161151-36161173 CTGAAGGGAAGAAGGAAGGAAGG + Intergenic
1125453480 15:39833267-39833289 ATGAATGGACAAAGAAAATATGG + Intronic
1125925527 15:43559857-43559879 TTAAAGGGACTAAGGATACACGG + Intronic
1125938670 15:43659408-43659430 TTAAAGGGACTAAGGATACACGG + Intronic
1126077606 15:44927536-44927558 CAGAAGGAAGAAAGGAAAGAAGG - Intergenic
1126081102 15:44962975-44962997 CAGAAGGAAGAAAGGAAAGAAGG + Intronic
1126286106 15:47012911-47012933 ATGAAGAGACAAAGGAAGCAGGG - Intergenic
1126375661 15:47994431-47994453 CAGATGGGGCAAAGGAGACAGGG - Intergenic
1126560668 15:50040335-50040357 CTGAAGAGGCAAAGGAATGAAGG - Intronic
1126925969 15:53586817-53586839 CACAAGGGAAAAAGCAAACATGG + Intronic
1127884944 15:63190204-63190226 GTAAAGGGACAGAGGACACAAGG + Intronic
1129336198 15:74853617-74853639 GTGAAGGGACAAAGGAAGACAGG + Intronic
1129367335 15:75064422-75064444 CCTAGGGGACAAAGGAAAGAGGG + Intronic
1130787020 15:87110164-87110186 ACGAATGGACAAAGAAAACATGG + Intergenic
1130993349 15:88889959-88889981 CAGAAGGGAGAAAGGAAGGAAGG + Intronic
1131682509 15:94738773-94738795 CTTAAGGAACTAAGGAAAGATGG - Intergenic
1131691121 15:94828726-94828748 CAGAAGAAAGAAAGGAAACAAGG - Intergenic
1132120183 15:99169300-99169322 CTGAAGGGAGACAGGCAACTGGG + Intronic
1132384915 15:101393425-101393447 CTGGAGGGACAAGAGGAACAAGG + Intronic
1133147340 16:3798946-3798968 ATGAAGGGAAAAACAAAACACGG + Intronic
1133604569 16:7373607-7373629 CAGAAATGACAGAGGAAACAGGG + Intronic
1134241939 16:12512975-12512997 CTGGGGGGACAAGGGAAGCAAGG - Intronic
1134314500 16:13106014-13106036 CTGCAGGGACAAAGGTAAAGAGG - Intronic
1135007497 16:18839592-18839614 CTGGAGGGACAGAGGAAGGAAGG + Intronic
1135098395 16:19584078-19584100 ATGAATGGATAAAGAAAACATGG - Intronic
1136113755 16:28081545-28081567 CTGAAGTGACAGAGGAGACACGG - Intergenic
1136636509 16:31527758-31527780 CTGAAGGTAGAAAGATAACAAGG - Intergenic
1138725221 16:59129954-59129976 ATGAAGGGATAAAGAAAATATGG - Intergenic
1138841721 16:60516728-60516750 ATGTAAGGACACAGGAAACATGG + Intergenic
1138973124 16:62170620-62170642 CTCTTGGAACAAAGGAAACATGG - Intergenic
1139828774 16:69779476-69779498 CAGAAGGAACAAAGGCAACTGGG - Intronic
1140181437 16:72722951-72722973 ATGAAGGGAGAAAGGGAAAATGG + Intergenic
1140527806 16:75638031-75638053 CTGAATGTTCAAAGGAAGCACGG - Intronic
1140676295 16:77333757-77333779 ATGAATGGATAAAGAAAACATGG - Intronic
1140802396 16:78500412-78500434 ATGAAGGGAAAAAGGAAGGAAGG - Intronic
1141014146 16:80432328-80432350 ATGAATGGATAAAGAAAACATGG + Intergenic
1141096714 16:81168167-81168189 TTCAAGGGACAAGGGAAGCAAGG + Intergenic
1141448514 16:84080435-84080457 GAGAAGTCACAAAGGAAACACGG + Intronic
1142417850 16:89952771-89952793 CTGAAAGGACAAAGCACCCATGG - Intronic
1142679188 17:1535623-1535645 CTGATGGCACAAAGCAAATATGG + Intronic
1143423584 17:6815307-6815329 CTGAAGGGAGAAAGTAAACTGGG + Intronic
1143847218 17:9781595-9781617 CTGTGGGGAAGAAGGAAACAGGG + Intronic
1144292038 17:13836136-13836158 CAGAAGGCAAAAAGGAATCACGG + Intergenic
1145745366 17:27315144-27315166 CTGAAGGACCAAAGGAAAATAGG + Intergenic
1146126073 17:30232625-30232647 CAGAGGGGCCAAAGGAAAGATGG + Intronic
1146151074 17:30472822-30472844 GTGAAGGGAAAAATGAAAAAAGG + Intergenic
1146449950 17:32964990-32965012 CCAAGGGGACAAAGGAAAGAGGG + Intergenic
1148390172 17:47266434-47266456 ATGGAAGAACAAAGGAAACAAGG - Intronic
1148933049 17:51142692-51142714 CTGAAGGGACGAAGAAGACCTGG + Intergenic
1149299589 17:55292756-55292778 GTGAATGGACAAAGAAAATATGG + Intronic
1149504170 17:57179558-57179580 CTGAAAGAAGAAAGGAAAGAAGG + Intergenic
1151234533 17:72709714-72709736 CTGAAAGGATACAGGAAATAGGG - Intronic
1151629034 17:75297548-75297570 CTGAAAGAACAAAGAAAAAAAGG - Intergenic
1152038164 17:77885858-77885880 AGGAAGGGAGAAAGGAAAGAAGG + Intergenic
1152825826 17:82464085-82464107 GTGAAGGGACACAGGACACAGGG - Intronic
1153227649 18:2910420-2910442 CTGATGGGACACAGGGAACTCGG - Intronic
1154096205 18:11417380-11417402 CTGCAGAGAGAAAGGAAACTGGG + Intergenic
1155322139 18:24630234-24630256 TACAAGGGACTAAGGAAACAAGG - Intergenic
1155533644 18:26793911-26793933 CAGAAGGGAGGAAGGAAAGAAGG - Intergenic
1155770827 18:29695999-29696021 CAGAATGGACAAAGAAAATATGG - Intergenic
1156135163 18:34028954-34028976 AGGAAGGGACAAAGGAAAAAGGG - Intronic
1156409392 18:36813202-36813224 CTGAAGGGGCAAAGAGAACTAGG + Intronic
1156818811 18:41344544-41344566 CTGAAAGGAGAAAAGAAAGAAGG + Intergenic
1157239837 18:45998636-45998658 CTGAAGGGAAAAAGGGAGGAAGG - Intronic
1157442818 18:47723387-47723409 CTGAAGGGACAAATGAGGGAGGG - Intergenic
1158080648 18:53586181-53586203 ATGAATGGATAAAGAAAACATGG + Intergenic
1158097220 18:53786912-53786934 CAGAGGAGAGAAAGGAAACAAGG + Intergenic
1158934360 18:62350857-62350879 CTCAATGGAAAAAGGAAAGAAGG - Intronic
1159007093 18:63022923-63022945 CTGAATGGATAAACAAAACATGG - Intergenic
1159371468 18:67532440-67532462 CAGAAGGCAGAGAGGAAACAAGG + Intergenic
1159435709 18:68414402-68414424 CTGTAGTGACAGAGGTAACAAGG + Intergenic
1159467547 18:68804174-68804196 ATGAAGAGACAAAGGAATCAAGG + Intronic
1159469162 18:68826996-68827018 CTGAAGCCACAAAGGCTACAAGG + Intronic
1160447647 18:78939897-78939919 CTGAGGGGACGAGGGACACAGGG + Intergenic
1160576962 18:79861728-79861750 CTGAAAGGAAAGAGGGAACAGGG - Intergenic
1160987751 19:1847425-1847447 ATCAAGGGACAGAGGTAACAGGG + Intronic
1161547542 19:4890845-4890867 TGGAATGGACAAAGGAAACCGGG - Exonic
1161558600 19:4958148-4958170 CTGAAGGGACTCAGGCCACAGGG - Intronic
1162059429 19:8085841-8085863 CAGAAGGGACAGAGGGAAGAGGG + Intronic
1162472219 19:10879198-10879220 AGGAAGGGACAAAGGAGAAAGGG + Intronic
1162751148 19:12830199-12830221 CTGAAGGGACATAGAGGACATGG - Intronic
1162847788 19:13406815-13406837 CTGAAGGCACAAGGGAGCCATGG - Intronic
1163884164 19:19951178-19951200 ATCAATGGATAAAGGAAACACGG + Intergenic
1165020190 19:32917812-32917834 CTGAAGGAAGGAAGGACACAGGG + Intronic
1165213026 19:34250615-34250637 GTGAGTGGACAAAAGAAACATGG - Intergenic
1165929127 19:39344671-39344693 CTGAAGGGATAATGGGAAAAGGG - Intronic
1167352289 19:48982859-48982881 CTGAATGAACAAATAAAACATGG - Intronic
1167486513 19:49766356-49766378 GTGGAGGGAGAAAGGGAACACGG + Intergenic
1168715618 19:58525462-58525484 CTGATGGGACAGAGAAGACATGG + Intronic
925545103 2:5007236-5007258 CAGAAGTGCCTAAGGAAACATGG + Intergenic
925712523 2:6755371-6755393 CAGAAGAGACTAAGGAAAAATGG - Intergenic
926534378 2:14092648-14092670 CAGAAGGAAGAAAGGAAAGAAGG + Intergenic
926786033 2:16519331-16519353 CTGAAGGGACAATTGAGAAAAGG + Intergenic
927050570 2:19324222-19324244 CAGAAGGGATAAAGGAAAGAAGG + Intergenic
928660559 2:33498006-33498028 GAGAAGGGAGAAAGGAAAGAAGG - Intronic
929013876 2:37474815-37474837 CTGAAAGGACATAAGAAACTGGG - Intergenic
930282436 2:49386418-49386440 GTGAATGGATAAAGAAAACATGG - Intergenic
930338271 2:50078595-50078617 CTGAAGGGACAAAGGAAACATGG - Intronic
930369510 2:50485595-50485617 TTGAGGGGACAAAGGATCCATGG + Intronic
930593027 2:53352880-53352902 ATGAAGGGATAAAGGAAATGTGG - Intergenic
930760820 2:55033553-55033575 CTTAAGGGCCATATGAAACAGGG - Intronic
930775546 2:55166750-55166772 CTGAAGATACAAAGGGATCAAGG + Intergenic
932257258 2:70298701-70298723 CAGAAAGGAGAAAAGAAACAAGG + Intronic
932267841 2:70383550-70383572 CGGAAGGCAAAAAGGAAGCAAGG - Intergenic
932280382 2:70486259-70486281 CTTAAGGGACGAAGGGTACAGGG + Intronic
932717439 2:74111818-74111840 CTTAAGGTACAGAAGAAACAGGG - Intergenic
932895440 2:75635017-75635039 CTGAAGTCACTAAGGAACCATGG - Intergenic
932939643 2:76148573-76148595 CTGAAGAGACGAAGGAGAAAAGG - Intergenic
933031700 2:77336271-77336293 AGGAAGGGAGAAAGGAAACAAGG + Intronic
933400274 2:81787693-81787715 CTAAGGGGACAGAGGAAACAAGG - Intergenic
934532865 2:95106458-95106480 CTGTAGGGAGAAAAGAAACAGGG + Intronic
935162812 2:100543940-100543962 AGGAAGGGAAAAAGGAAAAAGGG - Intergenic
935807968 2:106767544-106767566 CTGAAGAGGCAAGAGAAACAGGG - Intergenic
938314655 2:130317449-130317471 CGGAAGGGACAAAGGACATTCGG - Intergenic
939362630 2:141193357-141193379 CTGATTGGATAAAGAAAACATGG + Intronic
939569226 2:143820424-143820446 ATGAAAGGAGAAAGGAAAGAAGG + Intergenic
939608200 2:144277978-144278000 CCAAAGGGAGAAAGAAAACAAGG + Intronic
939913355 2:148009836-148009858 CTGAAGGGCTAAACAAAACAAGG + Intronic
941807797 2:169726327-169726349 ATGAATGGATAAAGAAAACATGG + Intronic
941899974 2:170668925-170668947 CTGCAGGGATAAAGGAAAGCAGG + Intergenic
942013750 2:171790343-171790365 CTGAAAAGACAAAGGAAGGAAGG - Intronic
942056218 2:172185362-172185384 TAGATTGGACAAAGGAAACATGG - Intergenic
942834053 2:180271324-180271346 ATGAATGGACAAAGTAAATATGG - Intergenic
942982491 2:182099366-182099388 ATGAAGGTGCAAAGGAAAGAAGG + Intronic
943127298 2:183810469-183810491 CTGAAGGAACAACGGTAGCAGGG + Intergenic
943336272 2:186619019-186619041 ATGAATGGATAAAGAAAACATGG + Intronic
943554390 2:189384131-189384153 ATGAAGGGATAAAGAAAACATGG - Intergenic
943627417 2:190215980-190216002 TTTGAGGGAAAAAGGAAACAGGG + Intronic
944814745 2:203364068-203364090 ATGAATGGACAAAGAAAATATGG - Intronic
945172271 2:207009102-207009124 CTGAAGGAACAAAGAAAATGAGG - Intergenic
946373466 2:219294620-219294642 CTGGAAGGAGAAAGGAAGCAGGG + Intronic
946388413 2:219400351-219400373 CAGCAGGGAACAAGGAAACAGGG - Intergenic
946490358 2:220143599-220143621 GTGAGGGGAGACAGGAAACAGGG - Intergenic
946578455 2:221101689-221101711 CTGAAGAGAAAAAGAAAACGTGG + Intergenic
946637902 2:221750676-221750698 CTGAAGGCACAAAGGACCCATGG - Intergenic
946973682 2:225123359-225123381 ATAAAGGAATAAAGGAAACAAGG - Intergenic
947008677 2:225540661-225540683 ATGAATGGATAAAGAAAACATGG - Intronic
947230170 2:227876552-227876574 CAGAAGGGATAAAGGTAGCACGG - Intronic
947475448 2:230443775-230443797 CTGAAGGGCCCAAGGAAACCAGG - Intronic
948089627 2:235282021-235282043 CAGAAGGCAAAAGGGAAACAAGG - Intergenic
948130651 2:235598116-235598138 CGGAAGACCCAAAGGAAACATGG - Intronic
948253982 2:236552749-236552771 CTGAAGGGACAAGGGAGGGAGGG + Intergenic
948261113 2:236605157-236605179 GTCAAGGGACAAAGGATCCAGGG - Intergenic
1169690252 20:8322376-8322398 CTGCAGGGAAAAAAGACACATGG - Intronic
1170267556 20:14484815-14484837 ATGAATGGATAAAGAAAACATGG - Intronic
1170392633 20:15891925-15891947 CTGAAGGGACAATGGGAAGGAGG + Intronic
1171066699 20:22024036-22024058 CTCAAGGGACTAGAGAAACAAGG - Intergenic
1172169817 20:32922695-32922717 CTGAAGGAAGCGAGGAAACATGG + Intronic
1172779620 20:37428339-37428361 CTGATGGGACAAAGAAGACGAGG - Intergenic
1173001794 20:39110321-39110343 CCGAAGGGAAAAAGGACAGAGGG - Intergenic
1173258113 20:41409354-41409376 CGGAGGGGGCAAAGGGAACAAGG + Intronic
1173405053 20:42757251-42757273 CTTAAGGGAAAAAGGAAAATAGG - Intronic
1173444657 20:43106690-43106712 ATGAAGGAACAAAGGAAAGAAGG + Intronic
1173545190 20:43892201-43892223 ATGAATGGATAAACGAAACATGG + Intergenic
1173762304 20:45573667-45573689 CTCAATGGATAAAGAAAACATGG - Intronic
1174299693 20:49572483-49572505 AGGAAGGGACAGAGGAAAGAAGG + Intergenic
1174613572 20:51818868-51818890 AAGAAGGAACAAAGGAAAGAAGG - Intergenic
1174728086 20:52886061-52886083 CTGAAGGTAGAAAGTAATCAAGG - Intergenic
1175226395 20:57446678-57446700 CAAAAGGGATAAAGGAAAGATGG + Intergenic
1176209724 20:63913224-63913246 CTAAGGAAACAAAGGAAACACGG - Intronic
1177389795 21:20453087-20453109 CTGAAGGATGAAAGAAAACAAGG - Intergenic
1177450462 21:21258921-21258943 ATCTTGGGACAAAGGAAACACGG + Intronic
1177660679 21:24079034-24079056 ATGAATGGATAAAGGAAATATGG - Intergenic
1177875776 21:26629717-26629739 ATGAATGGACAAAGAAAATATGG - Intergenic
1178552240 21:33550814-33550836 CTGAGGTGACAACGGCAACAGGG + Exonic
1179438192 21:41376236-41376258 CAGAAGTGACAAAGGAGACTGGG + Intronic
1179807679 21:43850267-43850289 CTGAAGGGAAAAATCAAGCAGGG + Intergenic
1180115828 21:45704339-45704361 CAGAAAGGAGTAAGGAAACATGG + Intronic
1180605696 22:17057494-17057516 CTGATGAGACAAAGAACACAGGG - Intergenic
1180956866 22:19745135-19745157 CTGCCGGGACAAGGGACACAGGG + Intergenic
1181101579 22:20544020-20544042 CTAAAGAAACAAAGGAAACAAGG - Intronic
1181683507 22:24512902-24512924 GTGAATGGATAAATGAAACATGG - Intronic
1181737496 22:24893241-24893263 CTGAAGACACAAAGGGAGCAAGG - Intronic
1182103600 22:27673843-27673865 CTGAAGGGACAGAGGGACCTGGG - Intergenic
1182306072 22:29369390-29369412 CTGAAGGAATAAAGGAATAAAGG + Intronic
1182389700 22:29982329-29982351 CTGGAGGTACTTAGGAAACAAGG + Intronic
1183040803 22:35176510-35176532 CTGAATGGTGAAAGGAAGCAAGG + Intergenic
1183165974 22:36147705-36147727 CTGAAAGGATGAAGGAAACCAGG + Intronic
1183414071 22:37672800-37672822 CTGAGGGGACATAGCAAGCAGGG + Intergenic
1183660719 22:39219417-39219439 ATGAAGAAACAAGGGAAACAAGG - Intergenic
1184111451 22:42397957-42397979 CTGTAGGGAGAAAGGAGTCAGGG + Intronic
1184712002 22:46256253-46256275 CTGCAGGCACCAAAGAAACAGGG + Exonic
951053987 3:18126263-18126285 AAGAGGGGAAAAAGGAAACAAGG - Intronic
951625480 3:24657829-24657851 GTGAATGGACAAAGAAAATATGG - Intergenic
952011623 3:28906448-28906470 CTGCAAGGAAAAAGGAAAGATGG - Intergenic
952070180 3:29625109-29625131 GTGAAGGCAAAAAGGAAGCAAGG - Intronic
952185505 3:30963587-30963609 ATGAAAGAACAAAGGAAAAAAGG - Intergenic
952239005 3:31510613-31510635 TAGAGGAGACAAAGGAAACATGG + Intergenic
952480698 3:33758853-33758875 CTGAAGTGTCAAATGAATCAAGG + Intergenic
952553922 3:34510445-34510467 CTGAAGGCAGAAAGGAATTAAGG + Intergenic
952712051 3:36441468-36441490 ATGAATGGATAAAGGAAATATGG - Intronic
952990285 3:38825626-38825648 CTAAATGGACAGAGGAAATACGG + Intergenic
953158723 3:40398479-40398501 CTGAAGGCAAGAAGGAAACCAGG - Intronic
953170170 3:40500004-40500026 CATAAGGGCCAGAGGAAACAAGG - Intergenic
953173658 3:40529883-40529905 CTGGATGGACAAAGGAACAAAGG - Intronic
953811658 3:46117734-46117756 CCTAGGGGACAAAGGAAAGAGGG - Intergenic
954371063 3:50169811-50169833 CAGAAGGAACAAAGGAACCTGGG - Intronic
954488035 3:50873066-50873088 GTGGAGGGGAAAAGGAAACAAGG - Intronic
955375693 3:58394771-58394793 CTGTAGGAACAAAGGAAAACAGG - Intronic
955516969 3:59735518-59735540 CTGAATGGAAGAAGGAAAGAAGG + Intergenic
956321894 3:68007214-68007236 AGGAAGGGAGAAAGGAAAGAAGG - Intronic
956323056 3:68020286-68020308 CTGCAGGGACAGGGGAAACTTGG + Intronic
956718385 3:72098156-72098178 CTGAAGGGACAAGGGGAGCAGGG + Intergenic
957306104 3:78460778-78460800 CTGAATGGATAAAGAAAATATGG - Intergenic
958181599 3:90067552-90067574 AGGAAGGGAGAAAGGAAAGAGGG + Intergenic
958582013 3:96039016-96039038 CAGAAGGGAAAGAGGAAAAAGGG + Intergenic
958856687 3:99393973-99393995 CTGCAGGCCCAAAGGGAACACGG + Intergenic
959169051 3:102822661-102822683 CTGAGGTAACAAGGGAAACAAGG - Intergenic
959601820 3:108195586-108195608 ATGAATGGATAAAGAAAACAAGG + Intronic
959678161 3:109060826-109060848 CAGAAGGCAAAAAGGAAGCAAGG + Intronic
959710574 3:109381921-109381943 CTGAATGTACAAATGAAAAATGG + Intergenic
960066398 3:113378262-113378284 ATAAAGGGATAAAGAAAACATGG - Intronic
960506810 3:118503912-118503934 CTGAAGAGAGCAAGGAACCAGGG + Intergenic
961514627 3:127424992-127425014 AGGAAGGCACAAAGGAAAGAAGG + Intergenic
962073819 3:132059343-132059365 AAGAAGGGAAAAAGGAAACAAGG + Intronic
962569186 3:136694746-136694768 CTCAAGGGACACAGGAAATCTGG + Intronic
962878521 3:139554313-139554335 CTGGAGGGAGAAAGGAAAGCTGG - Intergenic
963500254 3:146116603-146116625 ATGAATGGATAAAGGAAATACGG + Intronic
963550682 3:146718266-146718288 ATGAATGGATAAAGAAAACATGG - Intergenic
964999255 3:162931415-162931437 CAGAATGGAAAAAGAAAACAGGG + Intergenic
966311437 3:178598576-178598598 AAGGAGGGACAAAGGAAAGAAGG + Intronic
966476524 3:180354609-180354631 CTGTGGGGACAAAGGCAAAATGG - Intergenic
966556120 3:181262032-181262054 ATGAATGGATAAAGGAAATATGG - Intergenic
966730692 3:183148956-183148978 ATGAATGGATAAAGAAAACATGG + Intronic
966750179 3:183314395-183314417 CTGAAGGGCCAAAAGAAAAGAGG + Intronic
966756844 3:183379053-183379075 CAGGAGGGACAGAGTAAACATGG - Intronic
967830155 3:193911771-193911793 CTGAAGAGACAAAAGAAGGAGGG - Intergenic
968704870 4:2073138-2073160 CCGAGTGGACACAGGAAACAAGG - Intronic
968793490 4:2686185-2686207 TTGTAGGGACAAAAGTAACAGGG - Intronic
968885399 4:3328006-3328028 ATGAATGGATAAAGGAAACATGG + Intronic
969016765 4:4108452-4108474 GTGCAGGGACAAAGGAGATAGGG + Intergenic
969106013 4:4807611-4807633 CTGAAGGAACAAGTGAAGCAGGG + Intergenic
969480319 4:7443493-7443515 TTGTAGGGACTAAGGAACCAGGG - Intronic
969796394 4:9531451-9531473 CTGCAGGGACAGAGGAGATAGGG - Intergenic
970499635 4:16664404-16664426 CTGAAGGGACTAAGACAATATGG + Intronic
970510778 4:16779577-16779599 ATGAAGGGCCATAGGAGACATGG + Intronic
970574664 4:17415064-17415086 TGGAAGAGACTAAGGAAACATGG + Intergenic
970705685 4:18799077-18799099 CTGCATGCAGAAAGGAAACAAGG - Intergenic
971825738 4:31620190-31620212 CAGAAGGAAAAAAGGAAAGAAGG - Intergenic
974423722 4:61712472-61712494 CTGAATGGTCTAAGGATACATGG - Intronic
974907180 4:68072910-68072932 CTCAGGAGACAAAGGAAACTAGG - Intronic
974967425 4:68778857-68778879 ATGAATGGACAAAGAAAACATGG - Intergenic
974968335 4:68793152-68793174 ATGAATGGATAAAGAAAACATGG + Intergenic
974995399 4:69151524-69151546 ATGAAAGGACAGAGAAAACATGG + Intronic
975011760 4:69363813-69363835 ATGAATGGACAAAGAAAAGATGG + Intronic
975018939 4:69463240-69463262 CTGAAAATGCAAAGGAAACACGG + Intergenic
975026917 4:69560368-69560390 CAGAGGAGACAAAAGAAACAAGG + Intergenic
975603561 4:76128680-76128702 ATGAATGGATAAAGAAAACATGG + Intronic
975856514 4:78630504-78630526 CTTAAGCGAAAAAGGAAATATGG - Intergenic
976420091 4:84832103-84832125 ATGAATGGATAAAGAAAACATGG + Intronic
976796038 4:88933938-88933960 ATGAGGCCACAAAGGAAACAAGG - Intronic
976948416 4:90799032-90799054 CTGAAGGGAGGCAGGAACCATGG - Intronic
977794414 4:101145392-101145414 ATGAATGGATAAAGAAAACATGG + Intronic
977807668 4:101321994-101322016 GTTAAAGGACAAATGAAACAAGG - Intronic
978064794 4:104383510-104383532 CAGAAGGTAAAGAGGAAACAGGG + Intergenic
978146249 4:105375609-105375631 CTGAAGGGTCAAAGCAACCCTGG + Intronic
978971094 4:114807309-114807331 CTCTTGGGACAAAAGAAACATGG + Intergenic
979435249 4:120680565-120680587 GTGAATGGATAAAGAAAACATGG + Intergenic
979982931 4:127278377-127278399 CTGAATGAAGAAAGGAAATAAGG - Intergenic
980134107 4:128844041-128844063 CTAAAGGTTCAAAGGAAAAAAGG - Intronic
980966714 4:139528713-139528735 CTGAAGGGACAATGGCAATGTGG - Intronic
981130390 4:141152243-141152265 CTTCAGGGACAAAAGCAACATGG - Intronic
981252405 4:142619353-142619375 ATGAAGGGACAAAGAAAATATGG + Intronic
981721264 4:147803811-147803833 ATGAATGGATAAAGAAAACATGG - Intronic
982023868 4:151232764-151232786 CTGAAGAGAGAGAGGAATCAGGG - Intronic
982705317 4:158702689-158702711 ATGAATGGATCAAGGAAACATGG - Intronic
983155550 4:164342727-164342749 ATGAATGGACAAAGAAAATACGG + Intronic
983440302 4:167774061-167774083 CTGAAGGGGCAAAGAAAATGTGG + Intergenic
983933218 4:173475708-173475730 ATGAAAGGATAAAGAAAACATGG + Intergenic
984264997 4:177487739-177487761 CTGAACCGACAAAGGAACAAGGG - Intergenic
985023243 4:185713342-185713364 TTTAAAAGACAAAGGAAACATGG - Intronic
985131220 4:186740509-186740531 CTGAAGGGACAAGGGAAGGGAGG + Intergenic
985327500 4:188788187-188788209 CTAAATGGACAAAAGCAACAGGG - Intergenic
985364947 4:189219386-189219408 CTGAAGGAAGAAAGGAAAGAAGG + Intergenic
986623606 5:9702850-9702872 ATGGAGGGAGAAAGAAAACAAGG + Intronic
987077866 5:14401281-14401303 CTGAAAGGGCAAATGAAGCAAGG + Intronic
987291704 5:16514442-16514464 CTGAAGATACAAGTGAAACAAGG - Intronic
987500325 5:18700730-18700752 CTGAAGGTGGAAAGGAAAAAGGG + Intergenic
987911133 5:24147299-24147321 ATGAATGGATAAAGAAAACACGG - Intronic
988768709 5:34409298-34409320 CAGAAGGAGCAAGGGAAACAAGG + Intergenic
989119138 5:37986021-37986043 CTGAAGGGAAAGACAAAACAAGG + Intergenic
989348374 5:40454756-40454778 ATGAATGGATAAAGAAAACATGG - Intergenic
990010628 5:50993530-50993552 CTGCAGGGACAAAGGTAGGAGGG + Intergenic
990031147 5:51261230-51261252 ATGAATGGATAAAGAAAACATGG - Intergenic
990250639 5:53911352-53911374 AAGAAAGGACAAAGGAAAGAAGG - Intronic
990758718 5:59104706-59104728 AAGAAGGAACAAAGGAAAGAGGG + Intronic
991550071 5:67826091-67826113 CAGAAGTGGCAAAGGGAACAAGG + Intergenic
991653111 5:68876219-68876241 CTGAAGGGACTAAGACAGCAGGG + Intergenic
992167035 5:74063665-74063687 ATGAATGGATAAAGAAAACATGG + Intergenic
992416794 5:76559588-76559610 CTAAAGGCATAAAAGAAACATGG - Intronic
993187466 5:84637755-84637777 AGGAAGGGAGAAAGGAAAGAAGG - Intergenic
993260123 5:85647313-85647335 CCTAGGGGACAAAGGAAAGAGGG - Intergenic
993796680 5:92275864-92275886 GTGAAGTGACAGGGGAAACAAGG - Intergenic
994260370 5:97651575-97651597 GTGAAGAGACCAAGGAAACCTGG + Intergenic
995284010 5:110366172-110366194 CTGAAGGAATATAGGAAGCAAGG - Intronic
995308919 5:110689001-110689023 CAAAAGGGTCAAAGGAAAAATGG - Intronic
995355982 5:111238200-111238222 CTGGAGAGATGAAGGAAACAGGG - Intronic
995405012 5:111785144-111785166 CTAAAGGAAGAAATGAAACAGGG - Intronic
995545982 5:113231548-113231570 CTGTAGGAACAAAGTGAACATGG - Intronic
995853093 5:116567217-116567239 TTGCAGGGAAACAGGAAACAGGG - Intronic
996103398 5:119469662-119469684 ATGTAGGAACAAAAGAAACATGG - Intronic
996264847 5:121526401-121526423 ATGAATGGATAAAGGAAATATGG + Intergenic
996798409 5:127376082-127376104 CTGAGTGGACAAGGGAGACAAGG + Intronic
997833042 5:137168963-137168985 ATGAATGAACAAAGAAAACATGG + Intronic
998084630 5:139308972-139308994 CTAAAGGGACAGATGTAACATGG - Intronic
998512675 5:142726471-142726493 ATGAATGGACAAACTAAACATGG - Intergenic
998553742 5:143102841-143102863 CTGTAAGGACAAAGCAAGCAAGG - Intronic
999692232 5:154158037-154158059 GGGAAGGAAAAAAGGAAACAGGG - Intronic
1000893378 5:166826183-166826205 CTTAGGGGACAGAGGAGACATGG - Intergenic
1002585598 5:180245039-180245061 GTGGAGGGACAAAGGGAATAGGG - Intronic
1002996908 6:2295063-2295085 ATGAATGGATAAAGAAAACATGG + Intergenic
1003333328 6:5147639-5147661 TTGAAGGAAGACAGGAAACAGGG + Intronic
1003563909 6:7206437-7206459 CTGAATGGACAAATGAAGGAAGG - Intronic
1003585869 6:7389017-7389039 CTGTAAGGACAAATGAAAGATGG - Intronic
1003998097 6:11564118-11564140 CTGAATGGATAAATAAAACATGG - Intronic
1004247469 6:13993617-13993639 AAGAAGGGAGAAAGAAAACAAGG - Intergenic
1004751391 6:18565841-18565863 AAGAAGGAAGAAAGGAAACAAGG - Intergenic
1005458383 6:26043782-26043804 CTGATTGGACAAAAGAAACACGG + Intergenic
1005589224 6:27307850-27307872 CTGAATGGACAAAGAAAATGTGG - Intronic
1006178388 6:32137967-32137989 AGGAAGGGACAATGGAATCATGG + Intergenic
1006266523 6:32929983-32930005 ATGAAAGGAAAAAGGAAAGAAGG + Intergenic
1006377425 6:33679299-33679321 GTGAAGGCACGAAGGATACAGGG + Intronic
1007159874 6:39780495-39780517 GTGAAGGAACAAAGAAGACATGG - Intergenic
1008286634 6:49660695-49660717 AGGAAGGGACAACGGAAACCTGG - Intergenic
1008691160 6:53980971-53980993 ATGAATGGATAAAGAAAACATGG - Intronic
1009055500 6:58329791-58329813 CTGAAGGGAAAAAAGGAAAAAGG + Intergenic
1009061538 6:58402543-58402565 CTGAATGGAAACAGGAAACTTGG - Intergenic
1009235666 6:61120784-61120806 CTGAAGGGAAAAAAGGAAAAAGG - Intergenic
1009387579 6:63104546-63104568 ATGAAAGGATAAAGGAAACATGG - Intergenic
1009786830 6:68351171-68351193 CTGGAGGGAAAAATAAAACATGG + Intergenic
1010795617 6:80113697-80113719 CAAAAGGCACAAAGAAAACAAGG + Intronic
1011045894 6:83082278-83082300 ATGAAGGGGCAAAGAAAATATGG + Intronic
1012800887 6:103826228-103826250 ATGAATGGATAAAGAAAACATGG + Intergenic
1013981710 6:116137633-116137655 CTGAAGGGATAAAGAAAATGTGG - Intronic
1013993186 6:116278375-116278397 CTGAATATCCAAAGGAAACAGGG + Exonic
1014111387 6:117621857-117621879 CACAAGGAACAAAGGAGACAGGG - Intergenic
1015080244 6:129215682-129215704 ATAAAGTGACAAAGGATACAAGG - Intronic
1015225401 6:130851832-130851854 CAGGAGGCAGAAAGGAAACAGGG - Intronic
1015605244 6:134948016-134948038 CTGAATGGATAAAGAAAATATGG + Intronic
1016003071 6:139062096-139062118 AGGAAGGGAGAAAGGAAGCAAGG + Intergenic
1016026451 6:139292269-139292291 CCGAAAGGACAAACAAAACATGG - Intergenic
1016275441 6:142346642-142346664 TAGAATGGATAAAGGAAACATGG + Intronic
1016466950 6:144335310-144335332 CAGAAGGTACAAAGGAGAAAGGG - Intronic
1016595240 6:145790897-145790919 CTGCAGGGACAAAGGCCTCATGG - Intergenic
1017027534 6:150194392-150194414 CTCAAGAGACAAAACAAACAGGG - Intronic
1017030137 6:150213942-150213964 CTGAAGAGAATAAGAAAACAGGG - Intronic
1017039323 6:150295117-150295139 CTGAAGAGACAAAGGGAGGAAGG + Intergenic
1017078409 6:150641724-150641746 GGGGAGGGAAAAAGGAAACATGG - Intronic
1017593094 6:155998052-155998074 CTGAAAGGACAGAGAAAAAAGGG + Intergenic
1017905144 6:158752874-158752896 CAGTAGGGACCCAGGAAACAAGG - Intronic
1018143876 6:160864999-160865021 TTGAAGGGACAAATGAAACATGG - Intergenic
1018464855 6:164034581-164034603 TTCAAGAGACAATGGAAACAAGG + Intergenic
1018814966 6:167323737-167323759 TGGAAGGGACAGATGAAACATGG + Intergenic
1019340581 7:507134-507156 CTGAGGGGACAAAGGTCAGAGGG - Intronic
1020034050 7:4953135-4953157 CTGTAGGGATGGAGGAAACAGGG - Intronic
1020158280 7:5746074-5746096 CTCAAGGAACACAGGAAAAACGG + Intronic
1020840438 7:13211140-13211162 CAGAAGGTAAAAAAGAAACAAGG + Intergenic
1021102799 7:16602954-16602976 CTGAAGGTATACAGGAAGCATGG - Intronic
1021921090 7:25485845-25485867 TTGAAGGGACAAAGCAAAAGGGG + Intergenic
1022580470 7:31548360-31548382 TTCAAAGGACAGAGGAAACAAGG + Intronic
1023180916 7:37482539-37482561 CAGAAGGGAAAAATGAACCAAGG - Intergenic
1023830330 7:44035442-44035464 CAGAAGGGACTAAGGGAGCAAGG - Intergenic
1023958124 7:44904166-44904188 ATGAAAGGACAAAGGAAATGTGG - Intergenic
1024001110 7:45189863-45189885 CTGAAGGGAAGAAGGAAAGCAGG + Intergenic
1024780275 7:52839716-52839738 CTGGAGGGAAGAAAGAAACATGG - Intergenic
1024881204 7:54087457-54087479 ATGAATGGAAAAAGGAAACATGG - Intergenic
1025159963 7:56648584-56648606 CTGACTGCACAAAGAAAACATGG + Intergenic
1025717798 7:63978943-63978965 CTGACTGGATAAAGAAAACATGG + Intergenic
1026031926 7:66801748-66801770 ATGAATGGATAAAGAAAACATGG - Intronic
1027176395 7:75906525-75906547 CTGAACTGAGAAAGCAAACATGG - Intronic
1027491427 7:78832495-78832517 CTGCTGGGACAAATGAAAGATGG - Intronic
1027976394 7:85161508-85161530 CTGGAGGGGCAAAGAAGACAGGG + Intronic
1028208642 7:88045940-88045962 ATGAATGGATAAAGAAAACAGGG - Intronic
1028612265 7:92725008-92725030 CTGAATGGCAAAAAGAAACAGGG + Intronic
1029092782 7:98061314-98061336 ATGAATGGATAAAGGAAACGTGG - Intergenic
1029325807 7:99807870-99807892 CCTAAGGCACAAAGGAAAGAGGG - Intergenic
1029354092 7:100038181-100038203 CTGAAGGTACAAAACACACACGG - Exonic
1029740653 7:102489729-102489751 CAGAAGGGACTAAGGGAGCAAGG - Intronic
1029758647 7:102588901-102588923 CAGAAGGGACTAAGGGAGCAAGG - Intronic
1030133704 7:106225225-106225247 CAATAGGGACAAAGGAAAAAAGG + Intergenic
1030464472 7:109882527-109882549 CTGAAGGGACAGACGAGAAAGGG + Intergenic
1030790582 7:113722721-113722743 CTGATGGGACAAAGGAGATAAGG + Intergenic
1030891143 7:115001045-115001067 CTGAAGGGAAAAATGGAAGATGG + Intronic
1032012419 7:128355651-128355673 CTGAAGGGACCAAAGAATGAGGG - Intronic
1032141006 7:129329860-129329882 GAGAAGGGGCAAAGCAAACAAGG + Intronic
1032150194 7:129422392-129422414 CTGAAGAAACAAAGAAAAAAAGG - Intronic
1032209282 7:129897706-129897728 CCAAAGGGACAATGGAAACTGGG - Intronic
1032679557 7:134167863-134167885 GTAAAGGGATAAAGAAAACAGGG - Intronic
1033147322 7:138882641-138882663 AAGAAGAGAAAAAGGAAACAAGG + Intronic
1033584723 7:142765716-142765738 CTGAATGGAGACAGAAAACAGGG - Intergenic
1033832804 7:145273375-145273397 CTGAATGGACTAAGACAACATGG + Intergenic
1034026142 7:147707190-147707212 ATGTAAGGACAAAAGAAACATGG - Intronic
1034035901 7:147821703-147821725 CTGAAGAGAAACAGGAAAGAAGG + Intronic
1034580385 7:152036466-152036488 ATGAATGGATAAAGAAAACATGG - Intronic
1034606723 7:152323289-152323311 ATGAATGGATAAAGAAAACATGG + Intronic
1035260510 7:157658983-157659005 GTGAAGGGAGAAGGGACACATGG - Intronic
1035260523 7:157659022-157659044 GTGAAGGGAGAATGGACACAAGG - Intronic
1035281165 7:157779393-157779415 CTGCAGGGTCCCAGGAAACACGG - Intronic
1036771421 8:11580882-11580904 CTGCAGGAAGGAAGGAAACAGGG + Intergenic
1037292367 8:17364790-17364812 ATGAAGAGATAAAGAAAACATGG - Intronic
1037351771 8:17967080-17967102 CTGAAAGGACAAAATAAACTGGG - Exonic
1038150379 8:24938078-24938100 AGGAAGGGACAAAGGAAGGAAGG + Intergenic
1038370452 8:26984092-26984114 ATGAATGGACAAAGAAAATATGG + Intergenic
1038763806 8:30409068-30409090 ATGAATGGACAAACAAAACATGG - Intronic
1038864156 8:31421158-31421180 TGGAATGGACAAAGAAAACATGG - Intergenic
1039300975 8:36208478-36208500 CTAAAGGCACCAAGGAAGCAGGG - Intergenic
1040488802 8:47900513-47900535 CAGAAAGGACAAAGAAAAGAAGG + Intronic
1040747277 8:50660476-50660498 CAGAGGGGAGAAAGGAAAGAAGG + Intronic
1041191889 8:55363358-55363380 GTGAAAGGAAAAGGGAAACAGGG + Intronic
1041258092 8:55996582-55996604 ATGAAGGAAGGAAGGAAACAAGG - Intronic
1042001788 8:64131436-64131458 AAGAAGGGAGAAAGGAAAGAAGG + Intergenic
1042045735 8:64649433-64649455 ATGAATGGATAAAGAAAACATGG - Intronic
1042273950 8:66984086-66984108 CAGAAGAGACAAAGGCAAGAGGG + Intronic
1042275446 8:67000107-67000129 ATGAAGGAAAAAAGGAAATAAGG - Intronic
1043049058 8:75361917-75361939 CCTAGGGGACAAAGGAAAGAGGG + Intergenic
1043932961 8:86111460-86111482 ATGAATGGACAAAGGAAAGGTGG - Intronic
1044824259 8:96181305-96181327 CTGAAGTGAAAAGGGAAATATGG + Intergenic
1044964603 8:97562871-97562893 CTGAATGCATAAAGGAACCAGGG + Intergenic
1045245965 8:100441935-100441957 AGGAAGGGACGAAGGAAAGAAGG - Intergenic
1046518841 8:115298928-115298950 ATGAATGGACAAAGGAAATGTGG - Intergenic
1046561429 8:115842712-115842734 AGGAAGGGAGAAAGGAAAGAAGG + Intergenic
1046580195 8:116082848-116082870 ATGAAGGGAAAAAAGAAACAAGG + Intergenic
1046783016 8:118235705-118235727 TGGAAGGGGCAAAAGAAACAAGG + Intronic
1046796123 8:118374358-118374380 ATGAACGGATAAAGAAAACATGG - Intronic
1046902037 8:119534156-119534178 GTGAAGGGGCACACGAAACATGG + Intergenic
1047070813 8:121341441-121341463 GTGAGTGGACAAAGAAAACATGG - Intergenic
1047273518 8:123386286-123386308 ATGAACGGACAAACAAAACATGG + Intronic
1047691678 8:127361453-127361475 ATGAATGGATAAAGAAAACATGG - Intergenic
1047893679 8:129342033-129342055 CTGAAGAGACAAAGAAGACTGGG + Intergenic
1048414102 8:134207334-134207356 TTAAAGAGACAAAGGAAAGAAGG + Intergenic
1048417997 8:134248599-134248621 ATGAATGGATAAAGAAAACATGG + Intergenic
1048551716 8:135439232-135439254 TAGAAGGAACAAAGGAAAGAAGG + Intergenic
1049996461 9:1039572-1039594 CTGCAGGGACAAATAAAAAAAGG + Intergenic
1050032666 9:1402935-1402957 CTGAAAGGAAAAAGGAATTATGG + Intergenic
1052030309 9:23621082-23621104 CTGAAGGGAAAAGTGAGACAGGG + Intergenic
1052183055 9:25554617-25554639 TTGAAGGGACACAGAAAACCAGG - Intergenic
1052546430 9:29886610-29886632 ACTTAGGGACAAAGGAAACAGGG + Intergenic
1053139702 9:35674923-35674945 AAGAAGGGAGAAAGGAAAGATGG + Intronic
1053466840 9:38314748-38314770 ATAAAGGGAGAAAGGAAAGAAGG - Intergenic
1053586278 9:39462635-39462657 GTGAAGGCAGAAAGGAAACTAGG + Intergenic
1053730826 9:41055155-41055177 CTGAAGGAAGAAAGGAAGGAAGG + Intergenic
1054580027 9:66902594-66902616 GTGAAGGCAGAAAGGAAACTAGG - Intronic
1055591320 9:77817395-77817417 TGGAAGGAACAAAGGAAAGAAGG + Intronic
1058847878 9:108979932-108979954 CTGAATTAACAAAGGAAAAATGG - Intronic
1058894787 9:109389932-109389954 CAGAGGGCAAAAAGGAAACATGG - Intronic
1059215404 9:112556948-112556970 CTGAAGGAACAAAAGCAACTGGG - Intronic
1059672225 9:116502665-116502687 CAGAAGGAAGAAAGGAAAGAAGG + Intronic
1060166525 9:121421712-121421734 CAGAAGAGACAAAAGAAAAAAGG - Intergenic
1060260588 9:122070646-122070668 CTGAGGGGACAGAGGAATGAAGG + Intronic
1060331024 9:122670509-122670531 ATGAAGGGATAAAGAAAACGAGG + Intergenic
1060517028 9:124272270-124272292 ATGAATGAACAAAGAAAACAAGG - Intronic
1060647841 9:125297254-125297276 GTGAATGAACAAAGCAAACAAGG + Intronic
1060808015 9:126590208-126590230 CTGAAGAGCCAACGAAAACATGG + Intergenic
1060875273 9:127078634-127078656 CAGAAGGGACAAATGGGACAAGG - Intronic
1061336679 9:129942704-129942726 ATAAAGGGATAAAGGAAACATGG + Intronic
1061830042 9:133285905-133285927 CTGTAAGGACAAAGGAAAGAGGG - Intergenic
1062636008 9:137492305-137492327 CTGATTGGAAAAAGGAAACAGGG - Intronic
1185563298 X:1077194-1077216 CTGAAGGAAGAAAAGAAAAAAGG - Intergenic
1185763660 X:2707520-2707542 CTGATGAGAAAAAGTAAACATGG + Intronic
1185940177 X:4309145-4309167 ATGAATGGATAAAGAAAACATGG + Intergenic
1186501828 X:10057144-10057166 CTGAATGGATAAATAAAACATGG - Intronic
1186644290 X:11490003-11490025 CTGAAGGTGAAATGGAAACAAGG + Intronic
1186953129 X:14650385-14650407 CAGAAGAGAACAAGGAAACAGGG - Intronic
1187143591 X:16617543-16617565 CTCAAGGGAAGAAGCAAACATGG - Intronic
1187261413 X:17687951-17687973 CTGATGGGACAGAGGACACCTGG - Intronic
1187510076 X:19909803-19909825 TTGAATGGATAAAGGAAACATGG + Intergenic
1188372323 X:29384264-29384286 ATGAAGGGACAAAGAGAAGAAGG + Intronic
1188525498 X:31083611-31083633 CAGAAGGGAAAGAGGAAACATGG + Intergenic
1188841589 X:35024171-35024193 GAGAAGGGACAAGGGTAACAGGG + Intergenic
1189769441 X:44408953-44408975 CTGAAGGGACAGTGGAGAAAGGG - Intergenic
1190740219 X:53283670-53283692 CTGAAGGGAGGAAGGAATGAAGG + Intronic
1190896731 X:54626404-54626426 ATGAATGGATAAAGAAAACATGG - Intergenic
1190918918 X:54831581-54831603 ATGAATGGATAAAGAAAACATGG - Intergenic
1191801395 X:65084873-65084895 ATGAAGGGATAAAGAAAACATGG + Intergenic
1191930672 X:66367938-66367960 TTGAAGAGAGAAAGGAAAAAAGG - Intergenic
1192233123 X:69279335-69279357 CAGAAGAGACAGAGGGAACAGGG - Intergenic
1192654633 X:72980345-72980367 ATGAATGGACAAATGAAATATGG + Intergenic
1192655989 X:72995427-72995449 ATGAATGGATAAAGAAAACATGG + Intergenic
1193047581 X:77068931-77068953 CTAAGGGAACAAAGGAAAGAGGG + Intergenic
1193455462 X:81726153-81726175 CAGAAGAGACAAAAGAAAAAAGG + Intergenic
1193741198 X:85219756-85219778 ATGAAGGAAGAAAGGAAAGAAGG - Intergenic
1193899325 X:87157441-87157463 ATGAATGGATAAAGAAAACATGG - Intergenic
1194236368 X:91389170-91389192 ATGAATGGATAAAGAAAACATGG + Intergenic
1195397038 X:104422199-104422221 GGGAAGGGAAACAGGAAACAGGG + Intergenic
1195765688 X:108294491-108294513 CTTAAGGAACAAAGGAGAAAAGG + Intronic
1196021527 X:110995903-110995925 CTGAAGGACGAAAAGAAACATGG - Intronic
1196121353 X:112054349-112054371 TTGAAGGGCCCAAGGAAACATGG + Intronic
1196487204 X:116225967-116225989 ATGAAGGGACAAAGGAAATGTGG + Intergenic
1196527849 X:116748312-116748334 CTGAAGAGAGAAAGGAAAATGGG - Intergenic
1196657704 X:118236513-118236535 ATGAATGGATAAAGAAAACATGG - Intergenic
1196713168 X:118785079-118785101 GTGAAAGGTCAAAGAAAACATGG - Intronic
1196724668 X:118885478-118885500 CCTAGGGGACAAAGGAAAGAGGG + Intergenic
1197015170 X:121616224-121616246 ATGAATGGACAAAGAAAATACGG - Intergenic
1197189611 X:123631327-123631349 CTGAAGGGAAAAAGACAATAAGG - Intronic
1198615010 X:138447524-138447546 ATGAATGGATAAAGAAAACATGG - Intergenic
1198659741 X:138955311-138955333 CGGAGGGAACACAGGAAACATGG - Intronic
1199728276 X:150606313-150606335 GACAAGGGACAAAGGAACCAAGG - Intronic
1199811808 X:151357027-151357049 AGGAAGGGACAAAGGAGAAAGGG - Intergenic
1200422566 Y:2987145-2987167 CTGAAGTTACAAATGAAAGAAGG - Intergenic
1200569002 Y:4804342-4804364 CTGAGGGGACAGAGGCAAGAAGG - Intergenic
1200895476 Y:8371479-8371501 ATGAAAGGACAAGAGAAACAGGG + Intergenic