ID: 930340772

View in Genome Browser
Species Human (GRCh38)
Location 2:50111713-50111735
Sequence ATATTCAAAGGGCTGTGATT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 238
Summary {0: 1, 1: 0, 2: 1, 3: 21, 4: 215}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
930340772_930340775 -5 Left 930340772 2:50111713-50111735 CCAAATCACAGCCCTTTGAATAT 0: 1
1: 0
2: 1
3: 21
4: 215
Right 930340775 2:50111731-50111753 AATATTTAAAAACAGTTATTAGG 0: 1
1: 0
2: 11
3: 137
4: 1278
930340772_930340777 22 Left 930340772 2:50111713-50111735 CCAAATCACAGCCCTTTGAATAT 0: 1
1: 0
2: 1
3: 21
4: 215
Right 930340777 2:50111758-50111780 ATTTTCCCCACAGTCAGCCCAGG 0: 1
1: 0
2: 1
3: 18
4: 190

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
930340772 Original CRISPR ATATTCAAAGGGCTGTGATT TGG (reversed) Intronic
901177825 1:7317541-7317563 ATTTTCAAAGCCCTTTGATTGGG - Intronic
901688567 1:10958257-10958279 ATATTCAAAGGGATGTGAAATGG + Intronic
902055472 1:13597032-13597054 ATATACAAAAGCCTGTGTTTGGG + Intronic
902669361 1:17961909-17961931 ATATTCAAAGGGCGAGGAATCGG - Intergenic
903397196 1:23010826-23010848 ACATTCAATAGGCTGTGACTGGG + Exonic
907339168 1:53721931-53721953 ATTTTTAAAGTGCTGTCATTAGG - Intronic
907673409 1:56496780-56496802 CTATTCAAAGAGTTATGATTTGG - Intronic
910045594 1:82910395-82910417 CAATTCAAAGGGTCGTGATTAGG - Intergenic
910874553 1:91866149-91866171 ATATTCAAAAGGATCTGGTTGGG + Intronic
915021204 1:152780022-152780044 ATTCTCAAAGGACTGTGATGGGG - Intronic
915543276 1:156582125-156582147 ATACTCAGAGGGCTGGGTTTGGG + Intronic
915718950 1:157969775-157969797 ATATCCAAAGGGCTGCGGTGAGG - Intergenic
916687462 1:167160284-167160306 ATATATAAAGTGCTGTGGTTTGG - Intergenic
917488702 1:175478985-175479007 ATATTTAAAGGGCTTTGAAAAGG - Intronic
917513115 1:175684417-175684439 ATATTCAAAGGGCATCAATTAGG + Intronic
921310850 1:213841847-213841869 AAATTCCAAGGGAAGTGATTTGG - Intergenic
923139538 1:231149540-231149562 ATATACACAGGCCTGGGATTAGG - Intergenic
924062093 1:240185451-240185473 ATAATGAAAGGGATGGGATTGGG + Intronic
924091901 1:240509932-240509954 ATATTTGAAGGGCTGTCATGTGG + Intronic
1063373427 10:5537017-5537039 ATATTCAAAGGGCTGGAAATAGG - Intergenic
1063561661 10:7133938-7133960 AACTTCAAAGGGCTAGGATTAGG + Intergenic
1065030394 10:21580357-21580379 ATATTAATAGGACTGTGATAAGG - Intronic
1065378772 10:25068108-25068130 ACATTCACTGGGCTCTGATTGGG - Intergenic
1066694767 10:38068034-38068056 ATCTTCAAAGGGTGGTCATTAGG + Intergenic
1066997741 10:42579149-42579171 ATCTTCAAAGGGTGGTCATTAGG - Intronic
1067740689 10:48894043-48894065 ACATTCACACAGCTGTGATTGGG - Intronic
1069969999 10:72159299-72159321 ATGCTTAAAGGGCTGAGATTTGG + Intronic
1070620174 10:78003620-78003642 ACATTCAAAGAGCTGTGGTGAGG + Intronic
1071419336 10:85475510-85475532 ATTTTCAAAGGACTGTTATTTGG - Intergenic
1071534502 10:86416595-86416617 ACATTCAAAGGCTTGTGACTAGG + Intergenic
1074881454 10:117662790-117662812 ATATTTAAAGGCTTGTGACTGGG - Intergenic
1075540899 10:123312956-123312978 AGATTCAAAGGGCGGTAATTTGG - Intergenic
1077717727 11:4598774-4598796 AGCTTCAAATGGCTGTGATAAGG - Exonic
1078112586 11:8409996-8410018 ATATTTTAAGGGCTGTGCTTGGG + Intronic
1078333483 11:10445196-10445218 ATTTTCAAAGTGCTCAGATTTGG + Intronic
1079289554 11:19174964-19174986 ATCTTTAAAGGGTTTTGATTGGG + Intronic
1079360775 11:19768578-19768600 ATATCCAAAGGGCTGTCTTGAGG + Intronic
1079374893 11:19883047-19883069 AAATTCCAAGGGCAGTGGTTTGG + Intronic
1080446900 11:32345862-32345884 AGATTCACAGGGCTGTTATGAGG - Intergenic
1080749037 11:35135868-35135890 AAATTCTAGGGGCTGTAATTAGG - Intergenic
1085556397 11:77426424-77426446 ATTTTTAAAGGGCTGTTATTAGG - Intronic
1087098601 11:94344116-94344138 ATATAAAAAGGGCTCAGATTTGG + Intergenic
1087524197 11:99287076-99287098 ATATTTAAAAGGCTGTCATGTGG + Intronic
1088844585 11:113654204-113654226 AACTTCAAAGGCTTGTGATTTGG - Intergenic
1090187878 11:124750163-124750185 CTATCCAAAGGGCTGTCATGTGG - Intronic
1091375287 12:21183-21205 ATATCCAAAGGGCTGTCAGGTGG + Intergenic
1092033432 12:5309286-5309308 ATAAGCAAATGTCTGTGATTAGG - Intergenic
1093870585 12:24286458-24286480 ATATTTGAAGGGTTGTCATTTGG + Intergenic
1093882828 12:24425144-24425166 AACATCAAAGGGCTGTGGTTTGG + Intergenic
1095882548 12:47153512-47153534 ATATTCAAAGGACTTGAATTGGG - Intronic
1100730432 12:97461463-97461485 ATTTTTAAAGTGCTGGGATTAGG + Intergenic
1107797030 13:44063441-44063463 ATAGTCAAGGTGCTGTGATCAGG + Intergenic
1109250711 13:60016839-60016861 TTATGTAAAGGCCTGTGATTGGG - Intronic
1109554568 13:63955305-63955327 AAAAGCAAAGGGCTGGGATTGGG + Intergenic
1110993148 13:82069529-82069551 ATGTTCTCAGGCCTGTGATTGGG + Intergenic
1114443237 14:22767685-22767707 ATATTCAAATGGCTGAAGTTTGG + Intronic
1115400052 14:32946953-32946975 AGAATTAAAGGGCTGTGAGTTGG + Intronic
1115414755 14:33119362-33119384 ATATTAAAAGAGCTGTGAAAGGG - Intronic
1116338753 14:43694742-43694764 ATATTCAATGGATTGTGCTTTGG + Intergenic
1117657718 14:57973577-57973599 TAATGCAAAAGGCTGTGATTGGG - Intronic
1119530427 14:75356504-75356526 ATATTCTAAGGGCTTTGGATGGG + Intergenic
1120544758 14:85797339-85797361 ATTTTCAAAGGACTGTTCTTTGG - Intergenic
1121450195 14:94002104-94002126 CTATTCCAAGGGCTGGGACTAGG + Intergenic
1121880607 14:97497238-97497260 GTATTCATAGGGCTGTGAGAAGG - Intergenic
1121919079 14:97863901-97863923 CTACTCAGAGGGCTGTGATGAGG - Intergenic
1122053994 14:99079881-99079903 CCAATCAAAGGGCTGTGATAAGG + Intergenic
1122164152 14:99808780-99808802 ATGTTCTAAGGGCAGTGAATTGG - Intronic
1124397868 15:29320386-29320408 ATATTAATATGGCTGTTATTAGG - Intronic
1126508419 15:49436609-49436631 ATCTTCACAGGGCTCTTATTAGG + Intronic
1126532512 15:49726634-49726656 ATATTCAAAGTGCTGAAAGTGGG + Intergenic
1130354032 15:83113844-83113866 ATATTCCAATGGCTGAGATGAGG + Intronic
1130583271 15:85157695-85157717 ATAATCAAAGGGTTGTAATCTGG - Intergenic
1131318143 15:91359335-91359357 ATATTTAATATGCTGTGATTAGG + Intergenic
1134653470 16:15928864-15928886 ATATTTTAAGGGCTGTCATGTGG - Intergenic
1134673520 16:16073410-16073432 AACTTCAGAGGGCTGTGATGGGG - Intronic
1137410084 16:48221039-48221061 ATTTTTAAAGGGCTGGGAGTGGG + Intronic
1137483880 16:48875659-48875681 TTATTCACTGAGCTGTGATTTGG + Intergenic
1138121045 16:54401321-54401343 TTACTCAAAGGGCTGTCATTGGG + Intergenic
1138339607 16:56280114-56280136 AGATTCAAAGGCATGTGAGTTGG + Intronic
1138654859 16:58485392-58485414 CTATTAAAAGGGCTGAGAGTGGG - Intronic
1140906284 16:79412132-79412154 AGATTCACAGGCCTGTGACTGGG + Intergenic
1141355443 16:83341155-83341177 AGATTCAAGTGGCTGTGTTTGGG - Intronic
1141554019 16:84825175-84825197 ATATTCAAAGGACAGGGTTTGGG + Intronic
1143060496 17:4196593-4196615 ATATGCAAAGGGCCGTGCTATGG + Intronic
1147044456 17:37742974-37742996 ATACACAAAGAGCCGTGATTAGG - Intronic
1147220375 17:38925373-38925395 AGATACAAAGGGGTGGGATTGGG + Intergenic
1147486899 17:40824419-40824441 ATATTCAAAGGGTAATGATTTGG + Intronic
1147778597 17:42922574-42922596 ATACTCAAATAGCTGTGTTTAGG + Intergenic
1148672687 17:49422940-49422962 ATATTCAAAGTGCTGAAAGTGGG - Intronic
1148844425 17:50520775-50520797 ATATGCACAGGGTTGTGATAGGG + Intronic
1148855911 17:50579258-50579280 ATATTTGAAGGGCTGTCATGTGG + Intronic
1148928816 17:51111219-51111241 ATATTTAAAAAGCTGTTATTTGG - Intronic
1153080510 18:1218180-1218202 TTATTTAAACCGCTGTGATTTGG + Intergenic
1153337312 18:3937956-3937978 ATACTTACAGGGCTGTCATTAGG + Intronic
1156552860 18:38036600-38036622 CTAATCAATGAGCTGTGATTGGG - Intergenic
1157986984 18:52449294-52449316 ATTTTCAAAGGGCTCTGATATGG - Intronic
1159885368 18:73898510-73898532 AAATTGAAAGGCCTGTGGTTTGG - Intergenic
1160129022 18:76207765-76207787 ATCTCCAAAGGGATATGATTTGG + Intergenic
1162305843 19:9873086-9873108 AAATTCACAGAGCTGGGATTTGG + Intronic
1162795085 19:13082834-13082856 ATGCTCAAAGGGCTGTGGTGGGG + Intronic
1166886063 19:45961667-45961689 AAATTCAAAGGACTGGTATTTGG - Intronic
1168710533 19:58497623-58497645 ATATGCAAAGGGCTGTCCGTGGG - Intronic
925735029 2:6956471-6956493 CTACTCAAAGGGCTGTCATGGGG - Intronic
928275712 2:29898340-29898362 TTAATCAAAGGGATGTGAGTTGG - Intronic
929189062 2:39122856-39122878 ATATTTAAAGGGTTGTGATATGG + Intronic
930340772 2:50111713-50111735 ATATTCAAAGGGCTGTGATTTGG - Intronic
930904252 2:56547083-56547105 ATATTGAAAGGCAAGTGATTTGG - Intergenic
930949164 2:57116327-57116349 ATATTAAAAGGGCTGCTGTTGGG + Intergenic
931220235 2:60282803-60282825 TTCTTCAAAGGGAGGTGATTTGG - Intergenic
931677840 2:64715826-64715848 ATAGTTCAATGGCTGTGATTGGG + Intronic
932461791 2:71886822-71886844 AAGTTCAATGGGCTCTGATTGGG - Intergenic
932939672 2:76149037-76149059 AAATTCAGAGGGCTTAGATTAGG - Intergenic
933536066 2:83576135-83576157 AGCTTCATAGGTCTGTGATTTGG - Intergenic
935058200 2:99586027-99586049 ATATGAAAATAGCTGTGATTTGG - Intronic
935413583 2:102790699-102790721 AAATTCAAAGTGATGTGAGTAGG - Intronic
935452793 2:103229652-103229674 ATATTCAATGGGCTGTGCAAAGG - Intergenic
936654839 2:114472972-114472994 ATGTACAAAGGGCAGTGATGAGG - Intronic
936728477 2:115352732-115352754 GTAATCAAAAGGCTGTGAATGGG + Intronic
936850572 2:116892989-116893011 ATACTACAAGGGCTGGGATTTGG + Intergenic
937672357 2:124551753-124551775 AATTTCAAAGGCCTGTCATTTGG + Intronic
939271590 2:139946539-139946561 ATATTGAAAAGGCTGAGAGTAGG - Intergenic
939349908 2:141022587-141022609 TTATTCAAAGGGGTCTGGTTGGG + Intronic
940484548 2:154280710-154280732 ATATTCAAAGGGGACTGGTTTGG + Intronic
940799591 2:158118721-158118743 TTATAAAAAGGGCTGAGATTTGG + Intronic
941936297 2:170983655-170983677 ATAATCATAGGGCTGTTTTTGGG + Intergenic
944857437 2:203781488-203781510 ATATTCAAAGTGCTGTTGTGTGG + Intergenic
945159061 2:206870384-206870406 ATATTTAAAGTGCTGAGAATAGG - Intergenic
945582276 2:211610280-211610302 TTATTCATAGGGCAGTAATTTGG - Intronic
1168907244 20:1416293-1416315 TTTTGCAAAAGGCTGTGATTAGG - Intergenic
1169602669 20:7279575-7279597 ATATTCAAAGACATGTGAATAGG + Intergenic
1169642806 20:7773898-7773920 ATATTCAAAAGTCCTTGATTAGG - Intergenic
1170384204 20:15798263-15798285 AGATCCAAATGCCTGTGATTGGG + Intronic
1174937512 20:54887316-54887338 ATATTCAGTGTGCTGTGATCTGG - Intergenic
1174971250 20:55278179-55278201 GTATTCAAATGGCTCTGCTTTGG - Intergenic
1175785890 20:61711674-61711696 ATAGTCACAGGTCTGGGATTAGG + Intronic
1178358991 21:31932541-31932563 TCAAACAAAGGGCTGTGATTAGG + Intronic
1178466815 21:32856338-32856360 AAATTCAAAAGGGTATGATTTGG - Intergenic
1179779779 21:43691998-43692020 ATCCTCAAAGGGCTGTGAGTGGG + Intronic
1181871847 22:25905650-25905672 ATATTCAAGGAGCTGTAATACGG + Intronic
1182807896 22:33091053-33091075 ATATTTGAAGGGCTGTCATGAGG - Intergenic
1183418280 22:37695390-37695412 ATATATAAAGGGCTGTCATGAGG + Intronic
951963191 3:28351743-28351765 ATATTCTGAGGACTGTGCTTTGG + Intronic
953760755 3:45685007-45685029 ATATTAAAAGGTCTGTAAGTGGG + Exonic
953771832 3:45783464-45783486 TGATGCAAAGGTCTGTGATTGGG - Intronic
955426022 3:58790797-58790819 GTATCCAAAGGACGGTGATTAGG + Intronic
957141607 3:76366056-76366078 ATATGCAAAGGGCTGAGAAATGG - Intronic
957714408 3:83906399-83906421 ATATTAAATGGGCAGGGATTTGG - Intergenic
957810781 3:85219228-85219250 ATATTAAAAGCTCTCTGATTAGG - Intronic
958940225 3:100303815-100303837 ATATTGTAAGGGCTGTCATAGGG + Intronic
958992572 3:100864253-100864275 ACATTCAAAGGGCAGTGGTGTGG + Intronic
959597918 3:108147851-108147873 ATATACAAAGGGCTGTGCCAGGG - Intergenic
960112059 3:113854879-113854901 ATAATCAAAGGGCTATACTTAGG - Intronic
961764281 3:129196511-129196533 ATTTTCAAAGGCCTGTGGTGAGG + Intergenic
963084153 3:141421576-141421598 ACATTCAAAGGGCTGTCGTATGG + Intronic
964397279 3:156258604-156258626 AAATTCAAAAGGCTGTCATGTGG - Intronic
965885317 3:173438213-173438235 AAATTAAAAGGGTTTTGATTTGG - Intronic
965898107 3:173603375-173603397 ATATGCAAGATGCTGTGATTAGG + Intronic
966564086 3:181356771-181356793 ATATTCAAAGGGCTCAGAGAAGG + Intergenic
970707143 4:18817762-18817784 ATATTGAAAGTGCTGCGCTTAGG + Intergenic
971328638 4:25664509-25664531 CTATACAAAGGGCTATGACTTGG + Intronic
972267656 4:37478288-37478310 ATTTTCAGAGGGCTGTGTCTAGG - Intronic
974295783 4:59997270-59997292 AAATTCAAAAGGATATGATTTGG - Intergenic
975771879 4:77733805-77733827 ATATTTAAAGTGGTGTCATTTGG - Intronic
978120896 4:105078253-105078275 AAATTCAAAGTGCTGGGTTTAGG - Intergenic
978712780 4:111805943-111805965 ATATACAAAAGGCTGTGGGTTGG - Intergenic
979779980 4:124638714-124638736 TTCTTCAAAGGGCTGGCATTTGG - Intergenic
980754868 4:137145311-137145333 TTATTCAAAGGGTAATGATTTGG - Intergenic
983720245 4:170842697-170842719 ATATTCAAAGAACTGTGATTAGG + Intergenic
987114266 5:14713865-14713887 AGATCCAAAGGGCTGTGAGGAGG - Intronic
987175866 5:15308607-15308629 ATAATCAAAGGAGTGTAATTTGG - Intergenic
988907920 5:35809087-35809109 ATATTCAAAGGGTGGTGGTGAGG + Intronic
990281975 5:54260892-54260914 ATATTCCAAGTTCTGAGATTGGG - Intronic
993889958 5:93461756-93461778 TTATTCAAAGTGTTGTGCTTTGG - Intergenic
994393902 5:99213123-99213145 ATATTGCAAGGGGTGTGATATGG - Intergenic
994559422 5:101347937-101347959 ATCTTCAAAAGGCAGAGATTGGG + Intergenic
997523368 5:134537413-134537435 ATCTTCAAAGGGCTGTGGTGAGG - Intronic
998958414 5:147460441-147460463 ATCTTCATAGGTCTGGGATTAGG - Intronic
1000824927 5:166033219-166033241 ATATTATAAGGGCTTGGATTAGG + Intergenic
1001000233 5:167999136-167999158 ATAGTCAAAGAGCAGTGAGTTGG - Intronic
1002145303 5:177175564-177175586 ATTTTCAGTGAGCTGTGATTAGG + Intronic
1003700991 6:8465074-8465096 ATATTTAAAGGGCTATCATTGGG - Intergenic
1009492606 6:64311508-64311530 ATATTCCTAGTGCTATGATTTGG - Intronic
1010977977 6:82338155-82338177 ATATTGAAAGGACATTGATTAGG + Intergenic
1013658463 6:112270205-112270227 TTATTAAAAGGGCTGGGAGTGGG - Intergenic
1014566521 6:122956114-122956136 ATAGTCAAAGAACTGTGAATTGG + Intergenic
1014873847 6:126631160-126631182 GTATTCAAAGGGCTGCAGTTTGG + Intergenic
1014954769 6:127601045-127601067 ATCTTCAAATACCTGTGATTTGG + Intergenic
1016904974 6:149139139-149139161 ATATTCATAGGGCTTTCATGAGG + Intergenic
1019217545 6:170453508-170453530 ATATTCAAAGGGCTATTGTGAGG - Intergenic
1020875039 7:13683041-13683063 AGATTTAAAGGGATATGATTAGG + Intergenic
1021806963 7:24367259-24367281 ATGTTCATAGGGATGTGAATAGG - Intergenic
1022643413 7:32208872-32208894 ATATTCCTAGGGCTGTGGTTAGG - Intronic
1023803549 7:43855148-43855170 ATATTCACAGGTCTGGGAATTGG + Intergenic
1024972627 7:55084772-55084794 ATATTTAAAGGGCTTTTATTAGG + Intronic
1025190778 7:56893988-56894010 AAGTTCAAAGGGCTATGCTTAGG - Intergenic
1025681165 7:63682936-63682958 AAGTTCAAAGGGCTATGCTTAGG + Intergenic
1026267639 7:68809373-68809395 ATAATCAAAGAGCTGTGTTTGGG + Intergenic
1027589200 7:80096617-80096639 TTGTCCAAGGGGCTGTGATTGGG + Intergenic
1029666657 7:101999409-101999431 AAGTTCAAAGGGCTATGCTTAGG - Intronic
1030273557 7:107695506-107695528 ATTTTTAAAAAGCTGTGATTTGG + Intronic
1032275780 7:130454058-130454080 ATTTTCAAAGGTCAGGGATTAGG + Intergenic
1032490313 7:132319380-132319402 ATATTCCAGGTGCTGTGATGAGG + Intronic
1033570467 7:142623300-142623322 AAATTCAAATGGCTGTGGTGTGG - Intergenic
1034648753 7:152672670-152672692 ATATTCACAGGGCTATCCTTGGG + Intronic
1035924252 8:3710504-3710526 ACATTCAGAGGGCTGGGCTTAGG + Intronic
1039320798 8:36428374-36428396 ATATACAAATGGCTTTCATTTGG + Intergenic
1039576335 8:38626771-38626793 ATACTTAAAAGGCTGTCATTTGG + Intergenic
1040399259 8:47031874-47031896 ATATTTTAAGAGCTATGATTAGG + Intergenic
1040639572 8:49317570-49317592 ATATCCAAAGGGTTGTGTGTGGG + Intergenic
1041246335 8:55891935-55891957 ATATTGAAATGGCTGTGATGTGG + Intronic
1041361879 8:57063609-57063631 ATATGTAAAGGGCTTAGATTAGG - Intergenic
1042956680 8:74258607-74258629 AAGTTCAAAGGACTGTGGTTAGG - Intronic
1043960774 8:86416169-86416191 GTATTCAAATTGCTGTGAGTTGG + Intronic
1044334064 8:90955998-90956020 GTAGTCATAGGGCTGTGAGTTGG - Exonic
1044373944 8:91447164-91447186 ATGTTCAAAGGGATGTCATTTGG - Intergenic
1046065752 8:109195103-109195125 ATATTCACAAAGATGTGATTTGG - Intergenic
1050563688 9:6860135-6860157 ATTTTCAGAGGGCTGTAATGTGG + Intronic
1051200650 9:14618686-14618708 AAACTCAAAAGGCAGTGATTAGG - Exonic
1052503924 9:29328485-29328507 ATATACAAAGGGGAGTTATTAGG - Intergenic
1053077479 9:35145296-35145318 AAATTCAAAGGGGTATTATTTGG + Intergenic
1053541607 9:38979542-38979564 ATGTTCAAAGGTCTATGGTTGGG - Intergenic
1053806007 9:41802492-41802514 ATATTCAAAGGTCTATGGTTGGG - Intergenic
1054624532 9:67384367-67384389 ATGTTCAAAGGTCTATGGTTGGG + Intergenic
1056436626 9:86580909-86580931 ATTCTCAAAGGTCTGTGCTTTGG + Intergenic
1058871352 9:109204464-109204486 AAATTAAAAAGGCTTTGATTAGG - Intronic
1059649386 9:116301243-116301265 ATTTTCAAAGTGCTCTGGTTTGG + Intronic
1187072657 X:15903506-15903528 CTATTCAAAGGGCCCTGAGTGGG + Intergenic
1188827968 X:34860111-34860133 ATATTCAAAGAACTCTGATTAGG + Intergenic
1189453148 X:41158426-41158448 ATATTCAAAGTGCTGGGGTTGGG + Intronic
1192017325 X:67345785-67345807 ATATGGAGAGGGGTGTGATTGGG - Intergenic
1192050834 X:67722483-67722505 ATATTCAAAGCTATGTGTTTTGG + Intronic
1193908588 X:87274006-87274028 ACATTCAAACAGCTGGGATTTGG + Intergenic
1194750499 X:97678871-97678893 ATATTTTAAGGGCTGTCATGTGG - Intergenic
1195772139 X:108362768-108362790 ATATTTGAAGGGCTGTCATGGGG - Intronic
1196129105 X:112133587-112133609 ATAGTCAAAAGAATGTGATTTGG + Intergenic
1197669875 X:129264601-129264623 ATATTTAAAAGGCTGTCATATGG - Intergenic
1198294711 X:135274799-135274821 ATAAAGAAAGGGCTGTGATATGG + Intronic
1198499155 X:137225487-137225509 ATCATCAAAGGGCTGGTATTAGG + Intergenic