ID: 930341671

View in Genome Browser
Species Human (GRCh38)
Location 2:50123831-50123853
Sequence CTTCAGATGGATATTGTGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 208
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 198}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
930341671 Original CRISPR CTTCAGATGGATATTGTGGA AGG Intronic
905366427 1:37454062-37454084 CTCCAGATGGACAGTGTTGAGGG + Intergenic
906932156 1:50180623-50180645 CTTCCAATGCATAGTGTGGATGG + Intronic
907964623 1:59317245-59317267 TTTTAGCTGGATGTTGTGGAAGG + Intronic
910498545 1:87861776-87861798 CTTCAGGTGTAAATTGAGGAGGG + Intergenic
911397399 1:97328465-97328487 AATGGGATGGATATTGTGGATGG - Intronic
911714216 1:101111887-101111909 TTTCTGATGGATAATGAGGAAGG + Intergenic
911920950 1:103760880-103760902 TTTCAGATGTATATGGTAGAAGG - Intergenic
912179283 1:107198267-107198289 CTTCAAAATTATATTGTGGAAGG + Intronic
912240657 1:107904401-107904423 TTTCAGTTGGATAATGTAGATGG - Intronic
912997475 1:114545648-114545670 TTTCAAATGAATATTGGGGAGGG - Intergenic
913438030 1:118867503-118867525 CCTCTTATGGATATTGTTGAAGG - Intergenic
913670591 1:121094408-121094430 CTAGGGATGGATTTTGTGGAAGG - Intronic
914022357 1:143881847-143881869 CTAGGGATGGATTTTGTGGAAGG - Intergenic
914355528 1:146881317-146881339 CTTCAGTGTGATGTTGTGGAAGG - Intergenic
914660840 1:149789788-149789810 CTAGGGATGGATTTTGTGGAAGG - Intronic
915102892 1:153513413-153513435 CCTCTGATGCATATGGTGGAAGG + Intergenic
917304449 1:173612614-173612636 CATCAGAGGGAGACTGTGGAAGG - Intronic
920728428 1:208459892-208459914 CATGAGATGCATATGGTGGAAGG - Intergenic
920785693 1:209039043-209039065 CTTTAGATTCATATGGTGGAAGG + Intergenic
921296736 1:213711679-213711701 CTTCAGATGGAGTTTTTGCATGG + Intergenic
921658458 1:217769341-217769363 CCTCAGAGGGATATAGTGCAAGG - Intronic
922379913 1:225013131-225013153 CTTCAGATGGAGTTTTTGCATGG + Intronic
922889436 1:229048933-229048955 CATCAGATTCATATTGTGGGAGG + Intergenic
923109696 1:230880631-230880653 GTTCACATGGGCATTGTGGAAGG - Intergenic
923340162 1:233000165-233000187 GTTCAGAGGGATGTTCTGGAAGG - Intronic
923476643 1:234339460-234339482 TTTCAGATGGCTATTGTAAATGG - Intergenic
924860760 1:247919340-247919362 TCATAGATGGATATTGTGGATGG + Intergenic
1063775807 10:9262550-9262572 GTTCAGATGGACACAGTGGAAGG + Intergenic
1065679353 10:28213181-28213203 CTTCAGAAGGCTATGGTGGGAGG - Intronic
1066806300 10:39258881-39258903 CTGCAAAGGGATATTTTGGAGGG - Intergenic
1066932595 10:41783141-41783163 CTGCAAAGGGATATTTTGGAGGG + Intergenic
1068172658 10:53416188-53416210 CTTCAGTTGGTTTTTGTGTAAGG + Intergenic
1068475919 10:57524985-57525007 CTTAAGGTGGATTTTGTGGTTGG - Intergenic
1075052864 10:119195746-119195768 ATTCAGATGAATCTGGTGGAAGG + Intergenic
1075420633 10:122297927-122297949 CTTCAAATAGATATTCTGGGGGG - Intronic
1078161154 11:8840651-8840673 CTTGAGAGGGATGCTGTGGATGG - Intronic
1078867285 11:15309757-15309779 TTTCAGGAGGATATTCTGGAAGG + Intergenic
1081371388 11:42308599-42308621 CTTCAGAGGGAAATTGTGAGAGG - Intergenic
1082149385 11:48715462-48715484 CTGCAGAGGGATATTTTGTAGGG - Intergenic
1084176262 11:67423915-67423937 CTGCTGATGGAGTTTGTGGAGGG + Exonic
1084477647 11:69398162-69398184 CTTGAGAGGGATCTTGAGGAGGG - Intergenic
1086824531 11:91479428-91479450 TTTCATATGATTATTGTGGATGG - Intergenic
1089089953 11:115864170-115864192 CTTCACTTGGATTTTGTGTATGG + Intergenic
1092657596 12:10703345-10703367 CTTCAAAGGGATCTTATGGAAGG + Intronic
1093225427 12:16477970-16477992 CTACAGATGGATATTTTTAAAGG - Intronic
1093550998 12:20411222-20411244 CTGAAGATGGATATTGATGATGG - Intronic
1093835496 12:23824285-23824307 CTTCAGATGGAGTTTTTGCATGG + Intronic
1094877125 12:34661624-34661646 CTGCAAAGGGATATTTTGGAGGG + Intergenic
1096070143 12:48770770-48770792 CTTCATCTGGAAATTGTTGAAGG + Exonic
1096881110 12:54671797-54671819 CTTAACATGGATATTGAGTAGGG + Intergenic
1101535671 12:105614068-105614090 CTCCAGATGGATAGTGGTGATGG - Intergenic
1101767162 12:107712394-107712416 CTTCAGATGGATGGTTTGTAAGG + Exonic
1102232752 12:111274889-111274911 CTTCAGATGGACATAGTGGGAGG + Intronic
1104208531 12:126664061-126664083 CTTCAGATGAATATCATGTAAGG + Intergenic
1105401627 13:20101170-20101192 CTGCAGATGGATAGTGGTGATGG + Intergenic
1105541753 13:21321857-21321879 CTGAAGATGGATGGTGTGGATGG + Intergenic
1106616169 13:31330100-31330122 TTTGACATGGATATTGTGAATGG + Exonic
1108617616 13:52149546-52149568 ATTCAGATAGATATAGAGGAGGG - Intronic
1109209149 13:59514526-59514548 CTCCAGATGGAGACTCTGGATGG + Intergenic
1111972174 13:94928029-94928051 TTTCAGCTAGATATTCTGGATGG - Intergenic
1113735913 13:112679011-112679033 CATCAGAGGGAGACTGTGGAGGG + Intronic
1114745095 14:25137697-25137719 CTTCAGATGGAAATTTTGCGTGG - Intergenic
1116242291 14:42360122-42360144 CTTCAGAGGTATATTGGGGTGGG + Intergenic
1118416347 14:65540930-65540952 ATTTTGATGGATATTGGGGATGG + Intronic
1118924851 14:70182787-70182809 TTTAAGATGGAGTTTGTGGAGGG + Intronic
1119856914 14:77907842-77907864 CTCCTGATGGAGTTTGTGGATGG + Exonic
1121813467 14:96911793-96911815 CTCCGGGTGGATATTGTGGGTGG + Intronic
1127545519 15:59991369-59991391 CTTTGGATGGATATCGTGGATGG - Intergenic
1134615039 16:15644350-15644372 CTGTAGACGGGTATTGTGGAGGG + Intronic
1134810670 16:17164451-17164473 CTGGAGATGGATATTGGTGATGG - Intronic
1138168538 16:54826730-54826752 CCTCAGAGGGAGGTTGTGGATGG - Intergenic
1138843542 16:60538445-60538467 CTTCAGATGGAGTTTTTGCATGG + Intergenic
1139370454 16:66465586-66465608 CTGGAGATGGATAGTGTTGATGG - Intronic
1139978491 16:70834126-70834148 CTTCAGTGTGATGTTGTGGAAGG + Exonic
1140546996 16:75820327-75820349 CTGCAGATGGGCATGGTGGAAGG + Intergenic
1143940539 17:10536590-10536612 CTTCAGAGGGAGCTGGTGGAGGG - Exonic
1144908881 17:18661840-18661862 CCTCACATGCATATTATGGATGG + Exonic
1145932618 17:28696874-28696896 CTTGAAATTGATATTATGGAAGG - Exonic
1146053438 17:29569159-29569181 CCTCAGATGGTGACTGTGGAGGG - Intronic
1150070071 17:62142708-62142730 CTACACATGGATATTGGTGATGG - Intergenic
1150265267 17:63828132-63828154 CTTCAGATGGAGCTGGAGGAGGG + Exonic
1151001358 17:70380752-70380774 CCTCAGATGTATATTTAGGATGG - Intergenic
1160191704 18:76719995-76720017 CTGGAGATGGATAATGTTGATGG + Intergenic
1161003593 19:1923537-1923559 CTTCAGATGGAAACTGTGACCGG - Intronic
1161875940 19:6909638-6909660 CTTGAGATGGATAATGGTGATGG - Intronic
1163110025 19:15154234-15154256 CTCCAGTTGGTTATTGTTGAGGG + Intergenic
1166066265 19:40360979-40361001 CTTCAGTTGGATTTTGTAGTGGG - Intronic
1166742058 19:45120486-45120508 CTGCTGGTGGATATTGTGGTTGG + Intronic
1167924342 19:52810913-52810935 CATCAGAGGGAGACTGTGGAGGG - Intronic
1168543771 19:57233401-57233423 CCTCAGACGGAAATTGTGGCAGG + Intronic
930299868 2:49601980-49602002 TTTCAAATGGAAATTGTGAAAGG - Intergenic
930341671 2:50123831-50123853 CTTCAGATGGATATTGTGGAAGG + Intronic
931937719 2:67216728-67216750 CTTCAGCTGGAAATAGTGTAGGG - Intergenic
934144376 2:89077161-89077183 CTTCAGATGGTTATTTTTCATGG + Intergenic
934944221 2:98525376-98525398 CTTCAGATGGATTATGCAGATGG - Intronic
935527173 2:104184354-104184376 CTTCATTTGGATATTAAGGATGG + Intergenic
936711905 2:115141511-115141533 CTTCAGATGGAAATGATGGCAGG - Intronic
940407977 2:153327963-153327985 CTTCAGATGGTTTTTGTGTGAGG + Intergenic
940854796 2:158721701-158721723 CTGGAGATGGATAGTGTTGATGG + Intergenic
941408007 2:165115992-165116014 CTTCAGATGGAAATTTTCAAAGG + Intronic
941483332 2:166045844-166045866 ATTCTTCTGGATATTGTGGATGG - Intronic
941850814 2:170178105-170178127 CCTCAGATGACTATTGTGGGAGG - Intergenic
947875053 2:233462275-233462297 GTTCAGATGCGTATTGTGAAAGG + Intronic
1168872958 20:1146588-1146610 CTTCAGAGCGATATGGAGGAGGG - Intronic
1168930671 20:1620761-1620783 CTTCAGATGGGAACTGAGGAGGG + Intergenic
1169632134 20:7645946-7645968 CTTCAGAGGGACATTGTAGTAGG - Intergenic
1170684324 20:18555376-18555398 GTTCTGCTGTATATTGTGGAAGG - Intronic
1171343597 20:24448961-24448983 CTTGAGATGGACATTGGTGATGG - Intergenic
1171358921 20:24572913-24572935 ATTCAGATGGGTAGTGTGGATGG + Intronic
1177666558 21:24167294-24167316 CTTTTGGTGGCTATTGTGGATGG + Intergenic
1178571855 21:33745592-33745614 CTTCAGCTTGGTAATGTGGAGGG + Intronic
1179328006 21:40368805-40368827 TTTGAGATGGATATTTGGGATGG + Intronic
1182823198 22:33237075-33237097 CTCCAGAGGGATATAGTGGAAGG - Intronic
1184043465 22:41957999-41958021 CTGCAGAGGGATAGCGTGGAGGG - Intergenic
952098509 3:29984581-29984603 CTTCAGATGGGTTTTTTGTATGG + Intronic
952118937 3:30218049-30218071 CTTCAGATGTAGATTATGAAGGG - Intergenic
954137464 3:48588595-48588617 CTTCGGATGGGTGGTGTGGATGG - Intronic
955212329 3:56953787-56953809 CTGCAGATGGATGTTTTTGAAGG - Intronic
956663097 3:71618369-71618391 CTACAGATGGATCTCGAGGAAGG + Intergenic
957307466 3:78476368-78476390 TTTTAGATGGATATTCTGAAGGG - Intergenic
959334696 3:105049301-105049323 CTTCAGACAGTTACTGTGGATGG - Intergenic
960620656 3:119633591-119633613 TTTCAGATGAATGTTGTTGAAGG + Intergenic
961971834 3:130976543-130976565 TTGCAAATGGATATTTTGGATGG + Intronic
962930470 3:140031220-140031242 CTTCACATGCAGAATGTGGAGGG + Intronic
963498217 3:146095910-146095932 CATCAGAGGGAGACTGTGGAGGG - Intronic
963777601 3:149454956-149454978 CTTCAGATGGATGTTGCAGTTGG + Intergenic
966291299 3:178362083-178362105 CTTCAGATGGAGTTTTTGCATGG - Intergenic
968791635 4:2668505-2668527 ATTAAGATGCATATTGTGGGCGG - Intronic
970413870 4:15837397-15837419 ATACAGTTGGATAATGTGGAGGG + Intronic
974779643 4:66537298-66537320 CTTCAGAAGGAGTTTGTGTATGG + Intergenic
975207106 4:71657563-71657585 GTTCATATTGATATTGTGAATGG + Intergenic
976776217 4:88708998-88709020 CTTAAGAAGGAAAATGTGGATGG + Intergenic
978148124 4:105401530-105401552 CTACAAATGGATAGTGTTGATGG - Intronic
979043785 4:115835213-115835235 CTTCAGATGGAGTTTTTGCATGG - Intergenic
981830318 4:148992263-148992285 CTTCAGATGGATTTTGTGTGTGG + Intergenic
982544559 4:156717843-156717865 CTTTAAATTGATGTTGTGGATGG - Intergenic
984256041 4:177391279-177391301 TTTCAGAAGAATATGGTGGACGG - Intergenic
984813041 4:183811657-183811679 ATTCACATGGAAATTGTTGATGG + Intergenic
985027548 4:185753099-185753121 CCTCAGATGGAAATTGTTTATGG - Intronic
986239032 5:5940471-5940493 CTTCAAAAGGCTATTTTGGAAGG - Intergenic
986484452 5:8220985-8221007 CTTCAGATGGAGTTTTTGCACGG - Intergenic
988156910 5:27465245-27465267 CGTCAGGTGAATATTGTGGATGG + Intergenic
989369678 5:40692915-40692937 CTTCAGCTGGTTATACTGGAAGG - Exonic
989499312 5:42147872-42147894 ATTTAGCTGGACATTGTGGAGGG + Intergenic
989663302 5:43823536-43823558 CTTCAGATGATTTTTGTGTATGG + Intergenic
989838861 5:46033381-46033403 CTGCAAAGGGATATTTTGGAGGG + Intergenic
993029238 5:82685329-82685351 CTTCAGCTGGAAAATGGGGATGG - Intergenic
994437952 5:99762964-99762986 CTTCAGATGGAATTTCTGCATGG + Intergenic
994700308 5:103124903-103124925 CTTGAGATTTATGTTGTGGAGGG + Intronic
996905546 5:128595704-128595726 CTTCATATGGGTATTGTAAAAGG + Intronic
1001178686 5:169497550-169497572 CACCAGATGGTTATTTTGGATGG - Intergenic
1001932929 5:175685996-175686018 CTTCAGATGGACAGTGGTGAAGG - Exonic
1002176875 5:177405602-177405624 CTTCCAAAGGGTATTGTGGAGGG + Intronic
1003410403 6:5856936-5856958 CTGAAGATGGATGGTGTGGATGG - Intergenic
1004897168 6:20159716-20159738 ATACATATGTATATTGTGGAAGG - Intronic
1008120371 6:47608853-47608875 CATCAAATGTATATTATGGATGG - Intronic
1010616044 6:78013488-78013510 CTCCAGCTGGTTAGTGTGGAAGG + Intergenic
1011391328 6:86857120-86857142 CATCAGATTTATACTGTGGAAGG + Intergenic
1014145421 6:117992856-117992878 TTTCTGATAGATATTGTAGAGGG - Intronic
1014935590 6:127381433-127381455 CTTCTGATGGACAGTGTGTATGG - Intergenic
1016691423 6:146942777-146942799 CTTCAGATGGAGTTTTTGCATGG + Intergenic
1016700469 6:147048496-147048518 CTCCATATTTATATTGTGGAAGG - Intergenic
1018597252 6:165494876-165494898 ATTGAGATGGATAGTGTTGAAGG - Intronic
1018705060 6:166458005-166458027 CTACAGAAGGAGCTTGTGGATGG + Intronic
1022038300 7:26554874-26554896 CTGCAGATAGATATTTTGGAAGG + Intergenic
1024736587 7:52311640-52311662 CTTCAGTTGGATATTAAGTATGG - Intergenic
1024912934 7:54466773-54466795 CTTCATATGGAAAAGGTGGAAGG + Intergenic
1025139687 7:56451744-56451766 CTTCAGAAGTATTTTCTGGAGGG - Intergenic
1025239521 7:57259475-57259497 CTTCAGAAGCATTTTTTGGAGGG - Intergenic
1025522968 7:61764018-61764040 CTGCAAAGGGATATTCTGGAGGG - Intergenic
1025546721 7:62183045-62183067 CTGCAAAGGGATATTCTGGAGGG - Intergenic
1025574038 7:62612372-62612394 CTGCAAAGGGATATTTTGGAGGG - Intergenic
1027622542 7:80507820-80507842 CAACAAATGGATATTCTGGAAGG - Intronic
1027880394 7:83828333-83828355 CTGCAGTTGGATTTTGAGGAAGG - Intergenic
1030208169 7:106970699-106970721 CTTCAGATTGAGATTCTGCAAGG - Intergenic
1030465998 7:109904884-109904906 CTTCAGAGGAATACTGTGCAAGG + Intergenic
1031484913 7:122314417-122314439 CTTCGGAAGGATATTTTGGTAGG - Intergenic
1033484634 7:141776328-141776350 ACTCAGATGGATATAGTTGAGGG + Intronic
1033525727 7:142211163-142211185 CTTCGGATGGATTTTTTGCATGG - Intronic
1035074868 7:156170528-156170550 CTTGAAATGGATATTGCTGACGG - Intergenic
1036441734 8:8788004-8788026 CTTGAGATGGATCTTGAAGAAGG - Intronic
1037329570 8:17730878-17730900 CTGGAGATGGATATGGAGGATGG + Intronic
1038761610 8:30389356-30389378 TTTCAGATGGGTAGTTTGGAAGG + Intronic
1041633084 8:60110028-60110050 CTACTGATGGATATTTTGGTTGG + Intergenic
1042592741 8:70413283-70413305 CTAGAGATGGATAGTGTTGAGGG - Intergenic
1044779448 8:95728974-95728996 CATCAAATGGATATTATGGTAGG + Intergenic
1045256361 8:100526979-100527001 CTTCACACGTATAATGTGGAAGG + Intronic
1047189710 8:122666952-122666974 ATTCAGAGGGATATTTTGCAAGG + Intergenic
1047885077 8:129241244-129241266 CATCAGAGGCACATTGTGGATGG + Intergenic
1050159994 9:2708450-2708472 TTTTAAATGGATATTGTGTAAGG - Intergenic
1051695707 9:19766466-19766488 CTTCAGATGGAGTTTTTGCATGG + Intronic
1052548408 9:29911693-29911715 CTTGAAATGGCTATTGTGAAAGG + Intergenic
1054991976 9:71338350-71338372 CTTCAGAGGGAAATGGCGGAAGG + Intronic
1055822392 9:80282532-80282554 TTACAGATGGATAATCTGGATGG - Intergenic
1058695996 9:107559441-107559463 CTTCACATGGATCTTGTGCTAGG - Intergenic
1185691778 X:2161022-2161044 CTGCAGATGGATGGTGTTGATGG + Intergenic
1185820339 X:3196907-3196929 CTGCAGATGGATATTGGTGATGG + Intergenic
1187463537 X:19508471-19508493 CTGGAGATGGATATTGTTGATGG + Intronic
1188948118 X:36333716-36333738 CTTGAAATGGAGATTATGGAGGG - Intronic
1189422931 X:40873035-40873057 CTCCACATGGGTATTGTGAAGGG - Intergenic
1190858227 X:54317990-54318012 CTGGAGATGGATATTGCTGAGGG + Intronic
1193219347 X:78904176-78904198 CTTGAGATGGAGATTGATGATGG - Intergenic
1195434587 X:104828295-104828317 CTTCGGATGGATTTTTTGCATGG + Intronic
1196010341 X:110880284-110880306 CTGCAGATGGATGTTATGGTGGG - Intergenic
1196711816 X:118770703-118770725 CTTCAGCAGCATCTTGTGGATGG + Intronic
1198250984 X:134879020-134879042 CTTGGCAGGGATATTGTGGAGGG - Intergenic
1198738282 X:139811830-139811852 CTTCATATGGCTGTTGTTGAGGG + Intronic
1199488727 X:148375701-148375723 CTTGAGTTGGTTATTGTGTATGG - Intergenic