ID: 930341727

View in Genome Browser
Species Human (GRCh38)
Location 2:50124596-50124618
Sequence AGGGCACAATGGAAGTTTTG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 343
Summary {0: 1, 1: 0, 2: 5, 3: 39, 4: 298}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
930341727 Original CRISPR AGGGCACAATGGAAGTTTTG GGG (reversed) Intronic
900867489 1:5278656-5278678 AGGGCACGATGGAAGCTTCCAGG - Intergenic
902638963 1:17754280-17754302 AGGGCACAATGGAATTTTCTAGG - Intergenic
902673055 1:17988470-17988492 AGGGCACAAGAAAACTTTTGGGG - Intergenic
903799721 1:25957656-25957678 AGAGCCCAATAGAATTTTTGAGG + Intergenic
904067710 1:27767329-27767351 AGGACTCAAGGGAACTTTTGGGG - Intergenic
905098539 1:35497173-35497195 TGGGGACAAGGGAAGTTTTGGGG + Intronic
906267986 1:44449322-44449344 AGGAAAAATTGGAAGTTTTGGGG - Intronic
906354524 1:45092859-45092881 AGGGCAGGCTGGAAATTTTGGGG - Intronic
906683072 1:47743838-47743860 AGGGCACAAGGCAACTTTTTGGG - Intergenic
907370562 1:54000399-54000421 GGGGCACAAGGAAACTTTTGAGG + Intergenic
907419973 1:54340678-54340700 AGGGGACAAAGGAATTTCTGAGG + Intronic
908026564 1:59958289-59958311 AGGGCACAGTGGAAGGATTGGGG - Intergenic
910925723 1:92396564-92396586 TGGGCACAAGGGATCTTTTGGGG + Exonic
911320582 1:96409354-96409376 AGGGCACGATGGCAGCATTGTGG - Intergenic
912421835 1:109547875-109547897 AGGGCAGCATGGAAATTTTATGG + Intronic
913018059 1:114759167-114759189 AGAGCAAAAAGGCAGTTTTGAGG - Intergenic
913219138 1:116645375-116645397 AAGGCACAAGGGAACTTTTTGGG + Intronic
913288805 1:117252950-117252972 ATGGAACAAATGAAGTTTTGAGG - Intergenic
913557458 1:119982251-119982273 AGTGAACAATGGAAGTTAGGTGG - Intronic
914260445 1:145994723-145994745 GGGCCACAATGGCAGCTTTGGGG + Exonic
914339422 1:146746293-146746315 TGAGCACACTGGAAGATTTGAGG + Intergenic
914892673 1:151640827-151640849 AGGGCATGAGGGAACTTTTGAGG - Intronic
915819528 1:159007034-159007056 AGAGAAAAATGGAAGTATTGGGG + Intronic
916371212 1:164096664-164096686 AGGGCAGGAGGAAAGTTTTGGGG + Intergenic
916693788 1:167217013-167217035 TAGGCACAAGGGAAGTTTGGAGG - Intergenic
917011410 1:170477856-170477878 TGGGCATAAGGGAAATTTTGGGG + Intergenic
917123969 1:171669809-171669831 AAGGCACAAAGGAACTTTTAGGG - Intergenic
917299143 1:173554955-173554977 AAGGCAAAAAGGCAGTTTTGTGG + Intronic
918170140 1:181988638-181988660 AGGGCACAGTGGAAGGTTTGGGG - Intergenic
918562268 1:185883378-185883400 GGGGCATAAGGGAAGTTTTAAGG - Intronic
919716432 1:200782425-200782447 AAGGCACAAGGGAATTTTGGGGG - Intronic
919758062 1:201078212-201078234 AAGGCACCATGGATGTTTTTTGG + Intronic
920599920 1:207313837-207313859 ATGGCAAAAGGGAACTTTTGGGG - Intergenic
920984069 1:210867645-210867667 GGGGCACAAGGGACTTTTTGGGG - Intronic
921273044 1:213489852-213489874 AGGGCAAAATGGAAGTTATTTGG + Intergenic
921443439 1:215215897-215215919 AAGGGACAATGGAAATATTGTGG - Intronic
921721709 1:218479705-218479727 ATGGGAAAATGGAAGTTCTGAGG - Intergenic
923199843 1:231700797-231700819 AGGTCACAATGGAGGTATAGAGG + Intronic
924048839 1:240060257-240060279 AGGGCAAAAAGGAAGTATTATGG - Intronic
924138803 1:241000305-241000327 AAGGCACAAGGAAACTTTTGGGG + Intronic
924690405 1:246344250-246344272 GGGGCACAAGGGAACTTTTGGGG - Intronic
924757428 1:246954071-246954093 ATGGCAAAATGGAAGACTTGAGG - Intronic
1063316294 10:5009701-5009723 AGGGCAGAATGGAGGTGTGGTGG - Intronic
1063537957 10:6903549-6903571 AGGGCACAAAGAGAGTTTTTAGG - Intergenic
1064153248 10:12882824-12882846 GGGGAACAAGGAAAGTTTTGGGG + Intergenic
1066454361 10:35560258-35560280 AGGGCACGAAGGCAGTGTTGCGG + Intronic
1067792346 10:49297940-49297962 AGGGCAAAAGGCAAGTCTTGAGG + Intergenic
1068858557 10:61823220-61823242 AGGGCCAGATGCAAGTTTTGTGG + Intergenic
1068914385 10:62412875-62412897 GGGGCTCAATGGCAGTTTTGTGG - Intronic
1069181219 10:65361355-65361377 AAGGCACCATGGAATTTATGTGG - Intergenic
1070333434 10:75433698-75433720 TGGGCTCATGGGAAGTTTTGCGG - Intronic
1071103870 10:82071486-82071508 AGGGCGCAATGGAAGCCTTGAGG + Intronic
1071419521 10:85477924-85477946 AGGGCACAAGGTAAGTTCTCAGG - Intergenic
1072211498 10:93250560-93250582 ATGGAACCATGGAATTTTTGTGG + Intergenic
1073106071 10:101032605-101032627 AGGGCACAAGGGAGGTTGGGGGG + Intronic
1073171520 10:101513406-101513428 AGGGTACAAGGGATGTTTTTGGG - Intronic
1073225746 10:101917222-101917244 TGGGCACAGGGGAACTTTTGAGG - Intronic
1073438572 10:103537851-103537873 AAGGCACAAGGGAACTTGTGAGG - Intronic
1075069212 10:119309420-119309442 AGGGTCCAATGGGAGTGTTGAGG + Intronic
1077350383 11:2090495-2090517 AAGGCTGAATGGGAGTTTTGTGG - Intergenic
1077446791 11:2596727-2596749 AGGGCACAAAAAAACTTTTGGGG + Intronic
1077693506 11:4371551-4371573 AGGGCAGAATGGAAGTTACAAGG - Intergenic
1079421491 11:20294143-20294165 AGGGCATAATGGAAATTTCTGGG - Intergenic
1080224488 11:29945115-29945137 AGGGAGCAATGGAAATTTTATGG + Intergenic
1083976815 11:66128975-66128997 GGGGCACAAGGGATCTTTTGGGG + Intronic
1084305466 11:68279966-68279988 GGGGGATAAAGGAAGTTTTGGGG + Intergenic
1085454150 11:76656317-76656339 AGGGCGAAATGGAAGGTGTGAGG + Intergenic
1086014624 11:82152315-82152337 GGGACACAAGGGAACTTTTGGGG - Intergenic
1086781428 11:90910919-90910941 AGGGCATAAGGGAAATTTTAGGG + Intergenic
1087238009 11:95741862-95741884 AGGGGACAAGGGAACTTTTTGGG - Intergenic
1087806137 11:102557703-102557725 CGGGCACAAAGGAACTTTTCTGG + Intergenic
1088407035 11:109492900-109492922 AGGGCACAATGGAAATTTCTGGG + Intergenic
1088426263 11:109707502-109707524 AAGACACACTGGAACTTTTGAGG + Intergenic
1088732036 11:112692002-112692024 AGGGACCAATGGAAGTTCTAAGG - Intergenic
1090943946 11:131413092-131413114 TGGGCACAAGGGAAGAGTTGAGG - Intronic
1091150465 11:133323826-133323848 AGGGCATAAATGAAGTTTGGGGG - Intronic
1091270620 11:134308974-134308996 AGTACAAAATGGAAGTTTTGTGG + Intronic
1091517036 12:1195233-1195255 GGGGCAAAAGGGAACTTTTGGGG - Intronic
1091880060 12:3969817-3969839 AAGGCACATTGGAATTCTTGAGG + Intergenic
1092069683 12:5622549-5622571 AGGGAACAAATGAAGGTTTGAGG + Intronic
1093714370 12:22365276-22365298 AAGACACAATGGAAGTTTAATGG + Intronic
1093878435 12:24376391-24376413 AGGGCAGGATGGAACTTTAGAGG - Intergenic
1094197624 12:27766012-27766034 AATGCTAAATGGAAGTTTTGAGG - Intronic
1094210847 12:27889127-27889149 AGAGCAGGATGGAAATTTTGTGG - Intergenic
1095327091 12:40907687-40907709 AGGGGACAATCAAGGTTTTGTGG - Intronic
1095337670 12:41048220-41048242 TGGGCCCACTTGAAGTTTTGTGG - Intronic
1097241746 12:57580500-57580522 AGGGCACAGTAGCAGTTTGGTGG - Intronic
1098214488 12:68200881-68200903 GGGGCACAATGAAAGCCTTGTGG + Intergenic
1100842600 12:98628934-98628956 AGGGGGCAATGGATGCTTTGAGG + Intronic
1101147029 12:101850836-101850858 AGGGCACAAGTGATGTTTTTTGG - Intergenic
1101285383 12:103306662-103306684 AGGTCACAAAGCTAGTTTTGAGG + Intronic
1101299456 12:103463541-103463563 AGGGTACAATGGAAAGTTTTAGG - Intronic
1102044295 12:109820312-109820334 AGGGCAGAAAGGAAGGTCTGGGG - Intronic
1103761060 12:123250761-123250783 AGGGTACAATGGAGCTTTGGTGG + Intronic
1105366501 13:19770277-19770299 AGGGCACAAGGGAACTTCTGTGG + Intronic
1105945874 13:25188973-25188995 AGGGAAATATTGAAGTTTTGGGG + Intergenic
1106850745 13:33787958-33787980 AGGGCACAAGGGATCTTTTGGGG + Intergenic
1110218444 13:73048550-73048572 AGGGCACAATAAATATTTTGGGG - Intergenic
1113183344 13:107657532-107657554 AGTTTACAGTGGAAGTTTTGGGG + Intronic
1113394111 13:109928849-109928871 GGGGCACAAAGGAAATTTTGGGG + Intergenic
1113452049 13:110417586-110417608 AGGGCACAAGGAAAGTTTCTGGG - Intronic
1114055645 14:18965264-18965286 ATGGGGCAATGGAAGGTTTGAGG + Intergenic
1114106901 14:19436499-19436521 ATGGGGCAATGGAAGGTTTGAGG - Intergenic
1114745765 14:25145013-25145035 GGGGCAGGAGGGAAGTTTTGGGG - Intergenic
1115087369 14:29533711-29533733 TTGGCACAATGGAACTTTTTGGG - Intergenic
1116229414 14:42197132-42197154 AGGTCACAATGTCACTTTTGGGG + Intergenic
1116443185 14:44978240-44978262 AGGGCACAGTGGAATTTGGGAGG - Intronic
1117469585 14:56028705-56028727 AGGACAGAATGGATGTTTAGGGG + Intergenic
1117761170 14:59030524-59030546 GGGGCACAATGGAAGGTGTTTGG + Intergenic
1119303432 14:73588995-73589017 AGGGAACTATGCAAGTTTTGGGG - Intergenic
1120032758 14:79661315-79661337 AGGGCACAAAGGAAATACTGAGG + Intronic
1120290872 14:82569229-82569251 AGAACACAATGGAACTTTGGAGG + Intergenic
1123425012 15:20163923-20163945 AGGGCACAATGGCAGCTGGGAGG + Intergenic
1123534236 15:21170456-21170478 AGGGCACAATGGCAGCTGGGAGG + Intergenic
1124949838 15:34307034-34307056 AGGGCACAAAGAAACTTCTGGGG + Intronic
1125207880 15:37175589-37175611 TGGACACAAAGGAACTTTTGAGG - Intergenic
1125448021 15:39778361-39778383 AGAGCAAAATGAAAGATTTGTGG - Intronic
1126402571 15:48288136-48288158 AAGGCACAATTGATGTTTGGTGG + Exonic
1126822887 15:52522209-52522231 AAAGCACAAGGGAACTTTTGGGG + Intronic
1128077175 15:64834835-64834857 GGGGCACAAAGGAAGTTTCTAGG - Intergenic
1128348945 15:66876376-66876398 AGGGAACCATGGAAGTTTGTGGG + Intergenic
1130565425 15:84990359-84990381 GGAGCACAATAGAACTTTTGGGG - Intronic
1130978137 15:88792859-88792881 TGGGCACAGTGGGGGTTTTGTGG - Intergenic
1132132550 15:99296286-99296308 TAGGCACAATGGAAGTGATGAGG - Intronic
1132930981 16:2459162-2459184 AGGGCACAAAGGGAGTTGTCAGG - Intergenic
1135769646 16:25207559-25207581 AGGGCACATGGAGAGTTTTGGGG - Intergenic
1136859845 16:33691822-33691844 AGGGCACAATGGCAGCTGGGAGG - Intergenic
1137389225 16:48067595-48067617 AGGGGATAAAGGATGTTTTGTGG - Intergenic
1137622936 16:49888445-49888467 AGGGCACAAGGAAACTTTTGGGG + Intergenic
1137901132 16:52270775-52270797 GGGGCACAAGGAAATTTTTGGGG - Intergenic
1138330106 16:56206550-56206572 GGGGCACAAGGGAACTTTTGTGG + Intronic
1138341605 16:56293078-56293100 AGGTCACAAGGGGAGTTTTTGGG + Intronic
1139554922 16:67701620-67701642 GGGGCACAGGGGAATTTTTGTGG + Intronic
1139994854 16:70971054-70971076 TGAGCACACTGGAAGATTTGAGG - Intronic
1140021609 16:71244292-71244314 AGGGCAAAATTGAAGTCTAGTGG + Intergenic
1140614526 16:76645447-76645469 AAGGCATAATGGAACATTTGGGG - Intergenic
1141634978 16:85309826-85309848 CGGGCACAATGGATGTTTCTTGG - Intergenic
1141845614 16:86606677-86606699 AGGACACAAGGGAACTTTCGGGG - Intergenic
1203121350 16_KI270728v1_random:1540001-1540023 AGGGCACAATGGCAGCTGGGAGG - Intergenic
1143233907 17:5381531-5381553 AGAGCACGAAGGCAGTTTTGGGG + Intronic
1143340798 17:6209436-6209458 AGGGCACAAGAAAACTTTTGCGG - Intergenic
1144920419 17:18759257-18759279 AGGGCACAGTGGGAGGGTTGGGG - Intronic
1146608615 17:34285292-34285314 GGAGCCTAATGGAAGTTTTGGGG + Intergenic
1148694256 17:49549560-49549582 AGGGAACCATGGAAGGTTTGAGG + Intergenic
1151471707 17:74322446-74322468 AGGGCATAATGAGAGTTCTGTGG + Intergenic
1151544024 17:74781147-74781169 TGGGCACTATGGAAATTTGGGGG - Intronic
1151694619 17:75707827-75707849 AGGGCACTGTGGATGTTTTGTGG + Exonic
1152174512 17:78778811-78778833 AGAAAACAATGGAAGTTCTGAGG + Intronic
1152603642 17:81278007-81278029 AGGGCACAAAGGAAGCTAGGTGG + Intronic
1153055470 18:941957-941979 TGGGCACGATGGCAGGTTTGGGG - Intergenic
1154144077 18:11851636-11851658 AGGGCAACATGGAAGTTGCGAGG + Exonic
1154947575 18:21177302-21177324 AGAGCACAAGGGAACTTTTGAGG + Intergenic
1155505660 18:26530214-26530236 AGGGCAAAATTGAAGTTCTTAGG - Intronic
1156233420 18:35177774-35177796 AGGGCACCAAGGAAACTTTGAGG + Intergenic
1156429945 18:37061350-37061372 AGGGCACAAGGGAACTTTCTGGG + Intronic
1156473632 18:37392569-37392591 TGGGCACAAAGGAACTTTGGAGG - Intronic
1156591511 18:38494751-38494773 AGGGCAGCATGGTGGTTTTGGGG - Intergenic
1161390761 19:4019190-4019212 AGGGCAGAAGGGCAGGTTTGAGG + Intronic
1163328158 19:16618590-16618612 AAGGCAAAATGGGAGTTTTTGGG - Intronic
1165663668 19:37606043-37606065 GGGGCACAAGGGAAGTTTTGGGG - Intronic
1166381004 19:42355414-42355436 AGGGCCCAATTCACGTTTTGAGG + Intronic
1166628314 19:44381735-44381757 GGGGCACAAGGGAAATTTTGGGG + Intronic
1166674413 19:44731070-44731092 AGGGCACAGTGGACCTTTTCCGG + Intergenic
1166798856 19:45443970-45443992 CGGGGACACTGGAAGTTTAGGGG - Intronic
925137747 2:1532302-1532324 TGCGCACAGTGGGAGTTTTGTGG - Intronic
925402248 2:3583522-3583544 AGTGCACAATGGAAGAGTTTGGG + Intergenic
925695858 2:6577553-6577575 GGGGCACAGTGGAAGACTTGGGG + Intergenic
925957057 2:8977069-8977091 AGGGCACAAGGAAACTGTTGGGG + Intronic
926963620 2:18386441-18386463 AGGGAATAATGACAGTTTTGTGG + Intergenic
926969351 2:18451546-18451568 ATGGCACAGTGGAAAGTTTGTGG + Intergenic
928270556 2:29851092-29851114 AAGGCACAATGCAACTATTGGGG - Intronic
929012787 2:37462036-37462058 AGAGCACAAGGGAATTTTGGGGG - Intergenic
929369914 2:41210433-41210455 GGGGGACAATGCAAGTTTGGAGG - Intergenic
929739081 2:44584017-44584039 AGAGCACAAAGGAAGCTTTCTGG - Intronic
930341727 2:50124596-50124618 AGGGCACAATGGAAGTTTTGGGG - Intronic
930688666 2:54336232-54336254 AGGGCATAGGGGAACTTTTGAGG - Intronic
931769142 2:65482538-65482560 AGGACGCAAGGGAATTTTTGAGG - Intergenic
932824758 2:74929108-74929130 AGGGCAGAAGGTAAGATTTGAGG + Intergenic
935793390 2:106615107-106615129 AGGTCACAGTCGAAGATTTGGGG + Intergenic
935949862 2:108318912-108318934 AGGCCACACTGAAAGTTTAGAGG + Intergenic
936891805 2:117379299-117379321 AGGGCACAAGGGAAATTTAATGG + Intergenic
937103270 2:119288024-119288046 ATGGCACAAAGGAGGTTTTGGGG + Intergenic
938545277 2:132323456-132323478 AGGGCACAAGGGAAATTTTGGGG - Intergenic
941509426 2:166387292-166387314 AGGGCATAATGGAAGCATGGAGG - Intergenic
942663867 2:178295657-178295679 AGTGGACAATGGAAGTCCTGTGG + Intronic
943150235 2:184102477-184102499 AGGCCACAATGAAGTTTTTGAGG - Intergenic
943852951 2:192751390-192751412 AGAGAATAGTGGAAGTTTTGTGG - Intergenic
945214556 2:207419757-207419779 AGGGCACCATGGAAGTATCTTGG - Intergenic
946621386 2:221567511-221567533 AGGGCAGACTGGAATTTTTCAGG + Intronic
946684196 2:222250995-222251017 AGAGGACAGTGGAAGTGTTGGGG - Intronic
947438727 2:230097621-230097643 AGGGCACAAGGGAACTCTTTTGG - Intergenic
948491183 2:238314288-238314310 AAGACACATTGGAAGCTTTGTGG + Intergenic
1169087586 20:2836937-2836959 AGGGCACAGTGGCAGCTGTGAGG - Intronic
1169707354 20:8520631-8520653 AGGGCAACATGGAATTTTTGGGG - Intronic
1169835353 20:9872021-9872043 AAGGCACAAGGAAACTTTTGGGG + Intergenic
1170513922 20:17108100-17108122 AGGCATCAATGGTAGTTTTGGGG + Intergenic
1170591638 20:17776074-17776096 AGGGCACAATGGAAGGGCTGGGG + Intergenic
1171301674 20:24066540-24066562 GGGGCACAAGGGAACTTCTGAGG - Intergenic
1171874131 20:30556217-30556239 GGGGCACAAGGGAAATTTTTGGG - Intergenic
1172089822 20:32422214-32422236 GGGGCACAAGGAAACTTTTGGGG + Intronic
1172850852 20:37962998-37963020 AGGGCACAAGGGAAGTTTTTGGG - Intergenic
1173533299 20:43787329-43787351 AGGCTGCAAGGGAAGTTTTGGGG + Intergenic
1176091942 20:63322102-63322124 AGGGCCCAGGGTAAGTTTTGGGG + Exonic
1176673528 21:9755806-9755828 AGGGCACCAGGAAGGTTTTGGGG + Intergenic
1176699579 21:10028083-10028105 AAGGCACGAAGGAATTTTTGAGG + Intergenic
1178139150 21:29662342-29662364 AGGAGAGAATGGAACTTTTGGGG + Intronic
1178729668 21:35089129-35089151 GGGACACAAGGGGAGTTTTGGGG + Intronic
1180474121 22:15687816-15687838 ATGGGGCAATGGAAGGTTTGAGG + Intergenic
1181290335 22:21787468-21787490 ACGGCACAAGGCAACTTTTGGGG + Intronic
1183128623 22:35810838-35810860 GGGGCACAAGGAAACTTTTGGGG - Intronic
1183451622 22:37899044-37899066 AGTGGACAATGGAAGCATTGTGG - Intergenic
1184932916 22:47694641-47694663 AGGGCACAATGGAAAGTGTAGGG + Intergenic
950105589 3:10386331-10386353 AGGGCACAAAGGAGGGTCTGGGG + Intronic
950375080 3:12564740-12564762 TGGGCACAAGGGATCTTTTGGGG - Intronic
950660588 3:14464544-14464566 AGGGCAAAAAGGAAGCTTTCAGG - Intronic
950777218 3:15360674-15360696 ATGGCACAAGGAAAGTTTTTAGG - Intergenic
950993569 3:17468335-17468357 AGTGAACCATGTAAGTTTTGGGG - Intronic
951258084 3:20474314-20474336 ATGGCACAAAAGAAGTTATGAGG - Intergenic
951526231 3:23655701-23655723 AGGGCACCAGGAAACTTTTGGGG - Intergenic
951736420 3:25870296-25870318 AGGACACAAGGGAACGTTTGTGG - Intronic
952552433 3:34494654-34494676 AGAATACAATGGAAGTTTTGGGG - Intergenic
953085501 3:39662001-39662023 AGGGCACAAGGTAATTTTTTTGG + Intergenic
953421792 3:42759410-42759432 AGGGCACAAAGGAGGATTTTGGG - Intronic
953488274 3:43323947-43323969 GAGGCACAAAGGAAATTTTGGGG + Intronic
954118880 3:48483555-48483577 AGGTGACAATGGCGGTTTTGTGG - Intronic
954692309 3:52402124-52402146 AGGGCACGATGGAAGGAATGTGG + Exonic
955579271 3:60401499-60401521 GGGTCACAATGGGAGTTGTGGGG - Intronic
957849817 3:85792977-85792999 AAGGCACCATGGAACATTTGAGG + Intronic
958902700 3:99906673-99906695 GGGGGACAATTAAAGTTTTGAGG - Intronic
959018002 3:101157947-101157969 GGTCCACAATGGAGGTTTTGTGG + Intergenic
961747375 3:129073133-129073155 AGGGCACACGGGGAGTTTGGTGG + Intergenic
962030651 3:131596780-131596802 AGGGCAGACTGGAAATTTTAGGG - Intronic
962517016 3:136161716-136161738 TGGGCACAATGGAACCTTTTAGG + Intronic
962581869 3:136805289-136805311 AGGCCCCAGTGGAAGTATTGGGG - Intergenic
968079285 3:195835343-195835365 CTGGCACAATGAGAGTTTTGGGG + Intergenic
968802700 4:2753794-2753816 AGAGCAGAAGGGAAGTTTAGAGG - Intronic
969468624 4:7372708-7372730 AGGGCACAGGGGAACTTCTGGGG - Intronic
970316300 4:14831480-14831502 AAGGGCAAATGGAAGTTTTGGGG + Intergenic
973532776 4:51850027-51850049 GGGACACAAGGGAACTTTTGGGG - Intronic
974046079 4:56899655-56899677 AGGGCACAAAGGAATTTTGGGGG - Intergenic
976596211 4:86897525-86897547 AGGATACAATGGGAGTTTTGTGG - Intronic
976618284 4:87100426-87100448 AGAGCACAATGCAAGTCTTGTGG - Intronic
977233959 4:94484832-94484854 AGAGTACCATGGGAGTTTTGAGG + Intronic
980191808 4:129533930-129533952 AGTCCACAAAGGAAGTTTTGAGG + Intergenic
980467399 4:133203565-133203587 TTGGCACAATGGAAGTGTTCTGG + Intronic
980929091 4:139168543-139168565 AGCACACAAGGGAAGTTTGGAGG - Intronic
982400787 4:154965608-154965630 AGAGCAAAATGGAAGTTTTAAGG - Intergenic
984040520 4:174726972-174726994 ATGGCACAAAGGAAGATTTCAGG - Intronic
985401188 4:189595865-189595887 AGGGCACCAGGAAGGTTTTGGGG - Intergenic
986719678 5:10552169-10552191 AGTGGACAAGGGAGGTTTTGGGG - Intergenic
988448410 5:31313640-31313662 AGGCAACCATGGAAGTTCTGTGG + Intronic
990303284 5:54470676-54470698 GGGGCACTATGTAACTTTTGAGG + Intergenic
991701986 5:69324965-69324987 AGGGCATGAGGGAAGTTTTCTGG + Intronic
992144627 5:73833597-73833619 AGGACACAGTGGGAGTTCTGAGG + Intronic
992305079 5:75428854-75428876 AGGACACAAGGGAAGATTTTTGG - Intronic
994960242 5:106592170-106592192 AGGGCACAAAGGAACTTTCCGGG + Intergenic
995043459 5:107616983-107617005 AGAGCACATTAGCAGTTTTGTGG + Intronic
995096797 5:108245850-108245872 AGGGGTCAAAGGAAGTTTTGGGG + Intronic
995107606 5:108392536-108392558 GAGGCACAATGGAACTTTTTGGG + Intergenic
995760307 5:115555217-115555239 AGGGCACAATGGCAGCTATGGGG - Intergenic
996608331 5:125350086-125350108 ATGGCACAATAAAATTTTTGGGG - Intergenic
997290903 5:132734027-132734049 TGGGCATAAAGGAAATTTTGAGG + Intronic
999360949 5:150986451-150986473 AGGGTATAATGGAAGTTGTTAGG + Intergenic
999362034 5:150993346-150993368 AGGGTACAATGGAAGTTGTTAGG + Intergenic
1000209547 5:159097234-159097256 AGCGCCCACTGGATGTTTTGGGG - Intronic
1001343419 5:170867863-170867885 AGAGCACAAGGAAACTTTTGGGG - Intronic
1001465733 5:171964235-171964257 AGGGCCTGGTGGAAGTTTTGTGG - Intronic
1003720867 6:8700797-8700819 AGGTCACTCTGGATGTTTTGGGG - Intergenic
1004105660 6:12665380-12665402 AGGTGACAATGGAAGCTCTGGGG + Intergenic
1004588124 6:17022453-17022475 AGAGCACAGAGGATGTTTTGAGG - Intergenic
1005177826 6:23068070-23068092 AGGGCAGAATATAACTTTTGGGG + Intergenic
1005584567 6:27263452-27263474 AGGCCACAAGGGAACTTTTTAGG - Intergenic
1007604049 6:43103676-43103698 AGAGAACAAAGGAAGTTTTAAGG - Intronic
1008648178 6:53537254-53537276 AGGGCACAAGGGAACTTCTGGGG + Intronic
1010771368 6:79835370-79835392 AAGGCACCATGGAAGTATTTTGG + Intergenic
1011636918 6:89383066-89383088 AGGGCACAAGGGAACCTTTGGGG + Intronic
1012033869 6:94107001-94107023 TGGGGACAAAGAAAGTTTTGAGG - Intergenic
1012831483 6:104208880-104208902 AGAGCAAACTGGAAGCTTTGAGG + Intergenic
1013026684 6:106281312-106281334 AGGGCACAGAGGAACTTTTGTGG - Intronic
1013276686 6:108592147-108592169 AGGGCAGAAGGGAACTTTTCAGG + Intronic
1013896217 6:115091610-115091632 AAGGCACAATGGTAGTGGTGAGG - Intergenic
1015647962 6:135416009-135416031 AGGGCACAAAGTAACTTTTGGGG + Intronic
1015668863 6:135664962-135664984 AGGGCACAAATGAACTTTGGGGG + Intergenic
1015767060 6:136729960-136729982 AGGACACAAGGGAGGTTTTGTGG + Intronic
1016072095 6:139751206-139751228 AGGGCACAGGAGAGGTTTTGTGG - Intergenic
1016311287 6:142736370-142736392 AGGTCATAAGGGAATTTTTGAGG - Intergenic
1016849528 6:148602818-148602840 GGGGCACAAGGAAACTTTTGGGG - Intergenic
1018143893 6:160865211-160865233 AGGGGACAACGGATGGTTTGGGG - Intergenic
1020120282 7:5499302-5499324 AGGGCACAATGGGAGGTGGGAGG - Intronic
1023038119 7:36150646-36150668 AGGGCACAAAGAAACTTTGGGGG - Intergenic
1023167972 7:37362019-37362041 GGGGCACAAGGGAACTTTTCAGG + Intronic
1024116102 7:46195402-46195424 GGGGCACAAGCAAAGTTTTGGGG + Intergenic
1024682988 7:51713485-51713507 AGGGCACATTGCAAATCTTGGGG + Intergenic
1025241833 7:57283241-57283263 TGAGAACAATGGAAGTTTGGTGG - Intergenic
1026805361 7:73426071-73426093 AGGGCACAAGAAAACTTTTGGGG + Intergenic
1027996124 7:85427286-85427308 AGAGCAACATGGAGGTTTTGGGG + Intergenic
1029818688 7:103123864-103123886 AGGACACAAGGAAACTTTTGGGG + Intronic
1030469697 7:109948311-109948333 AGGGCAGAATGGGAGTTATTAGG - Intergenic
1030775340 7:113528058-113528080 AGGGCACAAGGGAACTTTCTGGG - Intergenic
1031501054 7:122517017-122517039 AGGGCATAAGGGAACTTTTGGGG - Intronic
1031874842 7:127127650-127127672 ATGGCACAAGGAAAGTTTTTAGG + Intronic
1032112122 7:129085050-129085072 AGGACACAAGGAAACTTTTGGGG - Intergenic
1032338154 7:131045412-131045434 AGAGCACAATGAAACGTTTGGGG - Intergenic
1034186282 7:149179636-149179658 AGGCCACAATGGAGGCTGTGGGG + Exonic
1039129905 8:34251249-34251271 AAGGCACAGTGGAAGGTTTTTGG + Intergenic
1039386127 8:37137280-37137302 AGGTCACAATTGAGGTTTTAAGG + Intergenic
1039730389 8:40269518-40269540 TGTGCACAGTGGAAGTTTTGGGG - Intergenic
1042744719 8:72095568-72095590 AGGTCACAGTGGAAGGTCTGTGG - Intronic
1043132523 8:76479463-76479485 AGCACACAATTGAATTTTTGGGG - Intergenic
1043538574 8:81233270-81233292 AGATCACAATGGAAGTTTGCTGG + Intergenic
1043713040 8:83446705-83446727 AGGGCACATTTGAGGTATTGTGG + Intergenic
1044385132 8:91578948-91578970 TGGGCACAAGGGAAATTTAGGGG - Intergenic
1045902640 8:107302418-107302440 AGGGTATATGGGAAGTTTTGAGG - Intronic
1046064339 8:109178616-109178638 AGGGGAAAATGGAAATTTTTAGG + Intergenic
1048019165 8:130522361-130522383 TGGGCACAGTGGAGCTTTTGTGG - Intergenic
1049504675 8:142989693-142989715 AGGGCAGAATGGATGTAGTGGGG + Intergenic
1050028602 9:1361934-1361956 AAGTCAAAATGGAAGTTTTGAGG - Intergenic
1053688713 9:40568735-40568757 AGGGCACAATGGCAGCTGGGAGG - Intergenic
1054299953 9:63369646-63369668 AGGGCACAATGGCAGCTGGGAGG - Intergenic
1056067286 9:82949836-82949858 AGGGCACAATAGCAGCTTTCGGG - Intergenic
1056251825 9:84756363-84756385 AGGGGAAAATGGAAGCATTGAGG + Intronic
1056498659 9:87186406-87186428 AGGGAAAAATGGAGGTTTTATGG - Intergenic
1059464681 9:114460494-114460516 AAGGAACAAAGGAGGTTTTGTGG + Intronic
1059910453 9:119037964-119037986 AGGACACAATGGATCTTTCGGGG + Intergenic
1060236623 9:121868203-121868225 AGGGCACCGTGGAAGTATTTGGG - Intronic
1060432181 9:123560172-123560194 TGGAGACAATGGAAATTTTGAGG + Intronic
1061375657 9:130222938-130222960 AGGGCACAATGGCAGGGATGGGG + Intronic
1061428948 9:130519092-130519114 AGAGGACAGTGGAAGCTTTGGGG - Intergenic
1061770143 9:132913353-132913375 AGGGCACAAAGGAACTTTTGGGG - Intronic
1186544843 X:10438534-10438556 AGGGCCTAAGGGAACTTTTGAGG - Intergenic
1186677858 X:11838591-11838613 TGGGCTCAAGGGAAATTTTGGGG - Intergenic
1192329597 X:70164424-70164446 TGGGCACAAGGGATCTTTTGGGG + Intronic
1193880106 X:86911138-86911160 AGAGAACAATGCAAGTATTGTGG - Intergenic
1195301235 X:103531829-103531851 GAAGCACAATGGGAGTTTTGGGG + Intergenic
1195475831 X:105284227-105284249 AGGCAACAAAGCAAGTTTTGGGG + Intronic
1195763078 X:108268091-108268113 AGGGCACAATGGAAGCTCATGGG - Intronic
1197143645 X:123145768-123145790 AGGGCACAAAGAAACCTTTGGGG - Intergenic
1197649938 X:129053483-129053505 AGTGCAGTATGGAATTTTTGAGG - Intergenic
1199062026 X:143368095-143368117 GGGACAAAAAGGAAGTTTTGAGG + Intergenic
1199542101 X:148968550-148968572 AGGACACAATGCAATGTTTGAGG - Intronic
1199902737 X:152193170-152193192 TGGGCACAAAGGAATCTTTGGGG - Intronic
1199926888 X:152476740-152476762 AGGGCACAAGGGAACTTTCTGGG + Intergenic
1202042261 Y:20697843-20697865 AGGGCACACTGGAAGCATTTGGG + Intergenic